heiko höfer, Sequence, mentalogital image, 2017

 

GTGTATCGAAGAATGGCCTCGCGGAGGCATGCGTCATGCTAGCGTGCGGGGTACTCTTGCTATCCA

TATGGTCCACAGGACACTCGTTGTTTTCGGATTTACCCTTTATGCGCCGGTTTTCAGCCACGCTTATG

CCCAGCATCGTTACAACCAGACCGATACTAGATGTATAAAGTCCGCCATGCAGACGAGACCAGTCG

GAGATTACCGAGCATTCTATCAGGTCGGCGACCACTAGTGAGCTACTGGAGCCGAGGGGTAACCAC

GATGCCGCTAAGAACCTCTCGGTCGACGCAAGCGATTACACTCCTGTCACATCATAATCGTTTGCTA

TTCAGGGGTTGACCAACACCGGAAAACTTTTCACTTGAAGTATTGTATACGACAGGGTGCGTGTACC

TACCAAACCTGTTTAAACTAAGTTCAGACTAGTTGGAAGTGTGTCTAGATCTTAGTTTTCGTCACTAGA

GGGCCCACGCTTTATTTTTATGATCCATTGATCTCCCAGACGCTGCAAGATTTGCAACCAGGCAGAC

TTGGCGGTAGGTCCTAGTGCAGCGGGACTTTTTTTCTATAGTCCTTGAGAGGAGGAGTCGTCAGTCC

AGATACCTTTGATGTCCTGATTGGAAGGACCGTTGGCCCCCCACCCTTAGGCAGTGTACTCAGTTCC

ATAAACGAGCTATTAGATATGAGGTCCGTAGATTGAAAAGGGTGACGGAATTCGCCCGAACGGGAAA

GACGGACAACTAGGTATCCTGAGCACGGTTGCGCGTCCGTATCAAGCTCCTCTTTATAGGCCCCGG

TTTCTGTTGGTCGTAGAGCGCAGAACGGGTTGGGGGGATGTACGACAATATCGCTTAGTCACCTTTG

GGCCACGGTCCGCTACCTTACAGGAATTGAGACCGTCCTTTAATTTCCCTTGCATATATGTTGCGTTTC

TTCGACCTTTTAACCGCTCCCTTAGGAGAAAGACAGATAGCTTCTTACCCGTACTCCACCGTTGGCA

GCACGATCGCATGTCCCACGTGAACCATTGGTAAACCCTGTGGCCTGTGAGCGACAAAAGCTTTAA

TGGGAAATTCGCGCCCATAACTTGGTCCGAATACGGGTCCTAGCAACGTTCGTCTGAGTTTGATCTAT

ATAATACGGGCGGTATGTCTGCTTTGATCAACCTCCAATAGCTCGTATGATAGTGCACCCGCTGGTGAT

CACTCAATGATCTGGGCTCCCCGTTGCAACTACGGGGATTTTTCGAGACCGACCTGCGTTCGGCATT

GTGGGCACAGTGAAGTATTAGCAAACGTTAAGTCCCGAACTAGATGTGACCTAACGGTAAGAGAATTT

CATAATACGTCCTGCCGCACGCGCAAGGTACATTTGGACAGTATTGAATGGACTCTGATCAACCTTCA

CACCGATCTAGAATCGAATGCGTAGATCAGCCAGGTGCAAACCAAAAATTCTAGGTTACTAGAAGTTT

TGCGACGTTCTAAGTGTTGGACGAAATGATTCGCGACCCAGGATGAGGTCGCCCTAAAAAATAGATTT

CTGCAACTCTCCTCGTGAGCAGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAACCGCGG

GCTGGGAGTCTGAGACATCACTCAAGATATATGCTCGGTAACGTATGCTCTAGCCATCTAACTATTCCC

TATGTCTTATAGGGGCCTACGTTATCTGCCTGTCGAACCATAGGATTCGCGTCAGCGCGCAGGCTTGG

ATCGAGATGAAATCTCCGGAGCCTAAGACCACGAGCGTCTGGCGTCTTGGCTAATCCCCCTACATGT

TGTTATAAACAATCAGTGGAAACTCAGTGCTAGAGGGTGGAGTGACCTTAAATCAAGGACGATATTAAT

CGGAAGGAGTATTCAACGCAATGAAGTCGCAGGGTTGACGTGGGAATGGTGCTTCTGTCCAAACAGG

TAAGGGTATGAGGCCGCAACCGTCCCCCAAGCGTACAGGGTGCACTTTGCAACGATTTCGGAGTCC

AAAGACTCGCTGTTTTCGAAATTTGCGCTCAAGGGCGAGTATTGAACCAGGCTTACGCCCAAGAACG

TAGCAAGGTGACTCAAACAAAGTACATCTTGCCCGCGTTTCATATGAATCAAGTTAGAAGTTATGGAGC

ATAATAACATGTGGATGGCCAGTGGTCGGTTGCTACACCCCTGCCGCAACGTTGAAGGTCCCGGATTA

GACTGGCTGGATCTATGCCGTGACACCCGTTATACTCCATTACCGTCTGTGGGTCACAGCTTGTTGTG

GACTGGATTGCCATTCTCTCAGTGTATTACGCAGGCCGGCGCACGGGTCCCATATAAACCTGTCATAG

CTTACCTGACTCTACTTGGAAATGTGGCTAGGCCTTTGCCCACGCACCTGATCGGTCCTCGTTTGCTT

TTTAGGACCGGATGAACTACAGAGCATTGCAAGAATCTCTACCTGCTTTACAAAGTGCTGGATCCTATT

CCAGCGGGATGTTTTATCTAAACACGATGAGAGGAGTATTCGTCAGGCCACATGGCTTTCTTGTTCTGG

TCGGATCCATCGTTGGCGCCCGACCCCCCCATTCCATAGTGAGTTCTTCGTCCGAGCCATTGTATGCC

AGATCGACAGACAGATAGCGGATCCAGTATATCCCTGGAAACTATAGACGCACAGGTTGGAATCTTAA

GTGAAGTCGCGCGTCCAAACCCAGCTCTATTTTAGTGGTCATGGGTTCTGGTCCCCCCGAGCCGCGG

AACCGATTAGGACCATGTACAACAATACTTATTAGTCATCTTTTAGACACAATCTCCCTGCTCAGTGGTA

TATGGTTTTTGCTATAATTAGCCACCCTCATAAGTTGCACTACTTCTGCGACCCAAATGCACCCTTACCA

CGAAGACAGGATTGTCCGATCCTATATTACGACTTTGGCAGGGGGTTCGCAAGTCCCACCCCAAACG

ATGCTGAAGGCTCAGGTTACACAGGCACAAGTACTATATATACGAGTTCCCGCTCTTAACCTGGATCGA

ATGCAGAATCATGCATCGTACCACTGTGTTCGTGTCATCTAGGACGGGCGCAAAGGATATATAATTCAAT

TAAGAATACCTTATATTATTGTACACCTACCGGTCACCAGCCAACAATGTGCGGATGGCGTTACGACTTA

CTGGGCCTGATCTCACCGCTTTAGATACCGCACACTGGGCAATACGAGGTAAAGCCAGTCACCCAGT

GTCGATCAACAGCTAACGTAACGGTAAGAGGCTCACAAAATCGCACTGTCGGCGTCCCTTGGGTATTT

TACGTTAGCATCAGGTGGACTAGCATGAATCTTTACTCCCAGGCGAAAACGGGTGCGTGGACAAGCGA

GCAGCAAACGAAAATTCTTGGCCTGCTTGGTGTCTCGTATTTCTCTTGGAGATCGAGGAAATGTTTCATG

ACCAAGGGAAAGGTCGCCCTACGAAATAGATTTGCGTTACTGTCTGCATAAGGAGTCCGGTGTAGCGA

AGGATGAAGGCGACCCTAGGTAGCAACCGCCGGCTTCGGCGGTAAGGTATCACTCAGGAAGCAGAC

ACAGAAAGACACGGTCTAGCAGATCGTTTATCGGCTAGGTCAAATAGAGTGCTTTGATATCAGCATGTC

TAGCTTTAGAATTCAGTTTAGTGCGCTGATCTGAGTCGAGATAAAATCACCAGTACCCAAAACCAGGCG

GGCTCGCCACGTTGGCTAATCCTGGTACATTTTGTAATCAATGTTCAGAAGAAAATTTGTGTTAGAAGGA

CGAGTCACCACGTACCAATAGCAACAACGATCGGTCGGACTATTCATTGTGGTGGTGACGCTCGGATT

ACACGGGAAAGGTGCTTGTGTCCCGACAGGCTAGGATATAATGCTGAGGCGTTACCCCAATCGTTCAG

CGTGGGATTTGCTACAACTTCTGAGTGCTACATGTACGAGACCATGTTATGTATGCACAAGGCCGACAA

TAGGACGTAGCCTTCGAGTTAGTACGTAGCGTGGTCGCATAAGCACAGTAGATCCTCCCCGCGCATCC

TATTTATTAAGTTAATTCTATAGCAATACGATCATATGCGGATGGGCAGTGGCCGGTAGTCACACGTCTAC

CGCGGTGCTCAATGACCGGGACTAAAGAGGCGAAGATTATGGTGTGTGACCCGTTATGCTCGAGTTCG

GTCAGAGCGTCATTGCGAGTAGTCGATTGCTTTCTCAATCTCCGAGCGATTTAGCGTGACAGCCCCAG

GGAACCCACAAAATGTGATCGCAGTCCATCCGATCGTACACAGAAAGGAAGGTCCCCATACACCGAC

GCACCTGTTTACACGTCGTATGCATAAACGAGCCGCACGAACCAGAGAGCATAAAGAGGACCTCTAGT

TCCTTTACAAAGTACAGGTTCGCCTGTCGCCAAGATGCCTTACCTAGATGCAATGACGGACGTATTCCT

CTGGCCTCAACGGTTCCTGCTTTCGCTGGGATCCAAGATTGGCAGCTGAAACCGCCTTTCCAAAGTGA

GTCCTTCGTCTGTGACTAACTGTGCCAAATCGTCTTGCAAACTCCTGATCCAGTTTAACTCACCAAATTA

TAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGT

TTTGGTCCGCCCGAGCGGTGCAGCCGATTAGGACCATCTAATGCACTTGTTACAAGACTTCTTTTAAATA

CTTTCTTCCTGCCCAGTAGCGGATGATAATGGTTGTTGCCAGCCGGTGTGGAAGGTAACAGCACCGGT

GCGAGCCTAATGTGCCGTCTCCACCAACACAAGGCTATCCGGTCGTATAATAGGATTCCGCAATGGGG

TTAGCAAATGGCAGCCTAAACGATATCGGGGACTTGCGATGTACATGCTTTGGTTCAATACATACGTGAC

CCAGTAGTTATCCTGTATCGGAACATCAATTGTGCATCGGGCCAGCATAATCATGTCATCTGGGAAGTGG

CCGTAGGATAAATAATTCAATAAAGATGTCGTTTTGCTAGTATACGTCTAGGCGTCACCCGCCATCTCTGT

GCAGGTGGGCCGACGAGACATTGTCCCTGATTTCTCCACTACTAATAGCACACACGGGGCAATACCAG

CACAAGCTAGTCTCGCGGGAACGCTCGTCAGCATACGAAAGAGCTTAAGGCACGCCAATTCGCACTG

TCAGGGTCACTTGGGTGTTTTGCACTACCGTCAGGTACGCTAGTATGCGTTCTTCCTTCCAGAGGTATGT

GGCTGCGTGGTCAAAAGTGCGGCATTCGTATTTGCTCCTCGTGTTTACTCTCACAAACTTGACCTGGAG

ATCAAGGAGATGCTTCTTGTGGAACTGGACAACGCATCAACGCAACGGATCTACGTTACAGCGTGCAT

AGTGAAAACGGAGTTGCTGACGACGAAAGCGACATTGGGATCTGTCTGTTGTCATTCGCGGAAAACAT

CCGTTCACGAGGCGGACACTGATTGACACGGTTTTGCAGAAGGTTAGGGGAATAGGTTAAATTGAGTG

GCTTAAAAATGCTATGTCTGGGATTAAAGTGTAGTAAACTGTGATTAACGGAGACGGTTTTAAGACAGGA

GTTCGCAAAATCAAGCGGGGTCATTACAACGGTTATTCCTGGTGGTTTAGGCGTACAATGTCCTGAAGA

ATATTTAAGAAAAAAGCACCCCTCGTCGCCTAGAATTACCTACCGCGGTCGACCATACCTTCGATTATC

GCGCCCACTCTCCCATTAGTCGGCAGAGGTGGTTGTGTTGCGATAGCCCAGTATGATATTCTAAGGCGT

TACGCTGATGAATATTCTACGGAATTGCCATAGGCGTTGAACGCTACACGGACGATACGAATTTATGTAT

AGAGCGGGTCATCGAAAGGTTATACTCTTGTAGTTAACATGTAGCCCGGCCCTATTAGTACAGCAGTGC

CTTGAATGACATTCTCATTATTAAATTTTCTCTACAGCCAAACGACCAAGTGCATTTCCACGGAGCGCGA

TGGAGATTCATTCACTCGGCAGCTCTGTAATAGGGACTAAAAGAGTGATGATAATCATGAGTGCCGCGT

TATGGTGGTGTCGGAACAGAGCGGTCTTACGGCCAGTCGTATTCCTTCTCGAGTTCCGTCCAGTTAAG

CGTGACACTCCCAGTGTACCCGCAAACCGTGATGGCTGTGCTTGGAGTCAATCGCATGTAGGATGGTC

TCCAGACACCGGGGCACCAGTTTTCACGCCCAAAGCATAAACGACGAGCAGTCATGAAAGTCTTAGA

ACTGGACGTGCCGTTTCTCTGCGAATAATACCTCGAGCTGTACCGTTGTTGCGCTGCCTAGATGCAGTG

CTGCTCTTATCACATTTGCTTCGACGACTGCCGCCTTCGCTGTTTCCCTAGACACTCAACAATAAGCGC

TTTTTGTAGGCAGGGGCACCCCCTATCAGTGGCTGCGCCAAAACATCTTCGGATCCCCTTGTCCAATC

AAATTGATCGAATTCTTTCATTTAAGACCCTAATATGACATCATTAGTGATTAAATGCCACTCCCAAAATTC

TGCCTAGAAATGTTTAAGTTCGCTCCACTAAAGTTGTTTAAAACGACTACTAAATCCGCGTGATAGGGGA

TTTCATATTTAATCTTTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTAT

AAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGGCGATTCTATAAGATTG

CACATTGCGTCTACTTATAAGATGTCTCAACGGCATGCGCAACTTGTGAAGTGCCTACTATCCTTAAACG

CATATCTCGCACAGTAACTCCCCAATATGTGAGCATCTGATGTTGCCCGGGCCGAGTTAGTCTTGTGCT

CACGGAACTTATTGTATGAGTAGTGATTTGAAAGAGTTGTCAGTTAGCTCGTTCAGGTAATGGTTCCTCA

CACTACGTCAAAATAAGAGAGCGGTCGTGACATTATCCGTGATTTTCTCACTACTATCAGTACTCACGA

CTCGATTCTGCCGCAGCCACGTATCGCCAGAAAGCCAGTCAGCATTAAGGAGTGCTCTGGGCAGGAC

AACTCGCATAGTGAGAGTTACATGTTCGTTGGGCTCTTCCGACACGAACCTCAGTTGGCCTACATCCTA

CCTGAGGTCTGTGCCCCGGTGGTGAGAAGTGCGCATTTCGTTCTTGCAGCTCGTCAGTACTTTCAGAA

TCATGGCCTGCACGGTAGAATGACGCTTATAATGGACTTCGACATGGCAATAACCCCCCGTTTCTACCT

CAAGAGGAGAAAAGTATTAACATGACTGCTGTCGGCACAAGGGCCAAAGAAGTCTCCAATTTCTTATTC

CCGAATAACATCCGTCTCCCTGCGGGAAAATCACCGACCGCATTTCATAGAAGCCTGGGGGAACAGA

TAGGTCTAATTAGCTTAAGAGAGTAAATCCTGGGATCATTCAGTAGTAACCACAAACTTACGCTGGGGCT

TCTTTGGCGGATTTTTACAGATACTAACCAGGTGATTTGAAGTAAATTAGTTGAGGATTTAGCCGCGCTAT

CCGGTAATCTCCAAATTAAAACATACCGTTCCATGAGGGCTAGAATTACTTACCGGCCTTCACCATGCC

TGCGCTATACGCGCCCACTCTCCCGTTTATCCGTCCAAGCGGATGCAATGCGATCCTCCGCTAAGATA

TTCTTACGTGTAACGTAGCTATGTATTTTACAGAGCTGGCGTACGCGTTGAACACTTCACAGATGATAGG

GATTCGGGTAAAGAGCGTGTTATTGGGGACTTACACAGGCGTAGACTACAATGGGCCCAACTCAATCA

CAGCTCGAGCGCCTTGAATAACGTACTCATCTCTATACATTCTCGACAATCTATCGAGCGACTCGATTAT

CAACGGGTGTCTTGCAGTTCTAATCTCTTGCCAGCATCGTAATAGCCTCCAAGAGATTGATGATAGTCAT

GGGCACAGAGCTGAGACGGCGCCGATGGATAGCGGACTTTCGGTCAACCACAATTCCCCACGAGAC

AGGTCCTGCCGTGCGCATCACTCTGAATGTACAAGCAACCCAAGAGGGCTGAGCCTGGACTCAGCTG

GTTCCTGGGTGAGCTCGAGACTCGGGGTGACAGCTCTTCATACATAGAGCGGGGGCGTCGAACGGTC

GTGAAAGTCATAGTACCCCGGGTACCAACTTACTGAGGATATTGCTTGAAGCTGTACCGTTTTAGGGGG

GGAACGCTGAAGATCTCTTCTTCTCATGACTGAACTCGCGAGGGTCGTGATGTCGGTTCCTTCAAAGG

TTAAAGAACAAAGGCTTACTGTGCGCAGAGGAACGCCCATTTAGCGGCTGGCGTCTTGAATCCTCGGT

CCCCCTTGTCTTTCCAGATTAATCCATTTCCCTCATTCACGAGCTTACCAAGTCAACATTGGTATATGAAT

GCGACCTTGAAGAGGCCGCTTAAAAATGGCAGTGGTTGATGCTCTAAACTCCATTTGGTTAACTCGTGT

ATCACCGCGATAGGCTGATAGAGGTTTAATATTGTATAGCAAGGTACTTCCGGTCTCAATGAATGGCCG

GGAAAGGTACGCGCGCGGTATGGGAGGGTCAAGGGGCCAATAGAGAGGCTCCTCTCTCACTCGCTA

GGAGGCAATTGTATAACAATGCTTACTGCATCGATACATAAAACGTGTCCATCGGTTGCCCAAACTGTG

AAGTGTCTATCACCCCTAGGCCCGTTTCCCGCATATAAACGCCAGGTTGTATCCGCATTTGATGCTACC

GTGGATGAGTCAGCGTCGAGCACGCGGCACTTATTGCATGAGTAGGGTTGACTAAGAGCCGTTAGATG

CCTCGCTGTACTAATAGTTGTCGACAGATCGTCAAGATTAGAAAACGGTACCAGCATTTTCGGAGGTTC

TCTAACTAGTATGGATAGCCGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAATCCAGTTGGTGT

CAAGCCATCCCCTGTCCAGGACGCCGCATGTAGTGAAACATACACGTTGCTCGGGTTCACCCCGGTC

CGTTCTGAGTCGACCAAGGACACAATCGAGCTCCGATCCGTACTGTCGAGAAACTTGTATCCGACCC

CCGCAGCTTGCCAGCTCTTCGGGTATCATGGAGCCTATGGTTGAACGTGTCCGATAACGAACTTCGAC

ATGATAAAGTCCCCCCCTCGCGACTACCAGAGAAGAAGACTACTGAGTTGAGCGTTCCCAGCACTTC

AGCCAAGGAAGCTACCAATTTTTAGTTTCCGAGTGTCACGTCTGACCTCGCGGGTAGATTGCCGAGCG

TAGAGCTTACGAGCCAGCGGAAACAGTAAGGCCTTTTTAAGTATGGGGAGTAAGTGATCGAACGCTTC

AGATGTGACCATATACTTAGGCTGGATCTCGTCCCGTGAATTTTAACCCTCACCAACTACGAGATATGA

GGTAAGCCAAAAAAGCACGTGGTGGCGCTCACCGACTGTTCCCAAACTGTAACTCATCGTTCCGTCA

AGGCCTGACTTACTTCCCGGCCCTTTCCATGCGCGGACCATACCGTCCTAGTTCTTCGGTTATGTTTCC

GATGTAGGAGTGAGCCTACCTCCGTTTGCGTCTTGTTACCAATGAAAAAGCTATGCACTTTGTACAGGG

TGCCATCGGGTTTCTGAACTCTCAGATAGTGGGGATCCCGGGAAAGGGCCTATATTTGCGGTCCAACTT

AGGCGTAAACCTCGATGCTACCTACTCAGACCCACCCCGCGCGGGGTAAATATGGCACTCATCCCAG

CTGGTTCTTGGCGTTCTACGCAGCCACATGTTCATTAACAGTTGTCTGGTAGCACAAAAGTATTACCATG

GTCCTAGAAGCCCGGCAGAGTTAGTTCGAACCTAATGCCACAAATGAGACAGGACGCCAATGGGTAC

CGGACATTAGGTCGAGCTCAGTTCGGTAACGGAGAGACCCTGCGGCGTACTTAATTATGCATATGAAAC

GCGCCCAAGTGACGCCAGGCAAGTCTCAGCAGGTTCCCGTGTTAGCTCGAGGGTAAACATACAAGC

CGATTGAACATGGGTTGGGGGCTTCAAATCGTCGAGGACCCCACAGTACCTCGGAGACCAAGTAGGG

CACCCTATAGTTCGAAGCAGAACTATTTCGAGGGGCGAGCCCTCATCGTCTCTTCTGCGGATGACTTA

ACACGCTAGGGACGTGGAGTCGATTCCATCGATGGTTATAAATCAAAGATTCGGAATGCTGTCTGGAGG

GTGAATCTAACGGTGCGTATCTCGATTGCTCAGTCGCTTTTCGTACTGCGCGAAAGTTCGTACCGCTCA

TTCACTTGGTTCCGAAGCCTGTCCTGATATATGAATCCAAACTAGAGCGGGGCTCTTGACATTTGGAGT

TGTAAATATCTAATACTCCAATCGGCTTTTACGTGCACCACCGCGGGCGGCTGACGAGGGTCTCACAC

CGAGAAACAAGACAGTTCCGGGCTGGAAGTAGCGCCGGCTAAGGAAGACGCCTGGTACAGCAGGAC

TATGAAACCGGTACAAAGGCAACATCCTCACTTGGGTGAACCGAAACGCGGTATCAAGGTTACTTTTTG

GATACCTGAAACAAATCCCATGGTAGTCCTTAGACTTGGGAGTCTATCACCCCTAGGGCCCATATCTGG

AAATAGACGCCAAGTTCAATCCGTATTCCGACGTACGATGGAACAGTGTGGGTGAGACGTGCTTCATTT

ATACCCTACGCAGGCTGGACCGAGGTCCGCAAGGCGCGGCGGTGCACAAGCAATTGACAACTAACC

ACCGTGTATTCATTATGGTACCAGGGACTTTAAGCCGAGTCAATGGAGCTCGCAATACAGAGTTTACCG

CATCTTGCCGTAACTGACAAACTGTGATCCACCACAAGTCAAGCCATTGCCTCTTAGACACGCCGTTA

GAGTAATTATGTAAACTTTGCGCGGCTTGACTACGACTCGTTCAGTCACGTCCGAGGGCACAATCCTAT

TCCCATTTGTATGTTCAGCTATCTTCTACCCATCCCCGGAAGTTAAGTAGGTCGTGAGATGCCGAGGAG

GCTCTCGTTCATCCCGTGGGACATCAAGCTTCCCCTTGATAAAGCACCCCGCTCGGGTATGGCAGAG

AGGACGCCTTCTGAATTGTGCTATCCCTCGACCTTATCAAAGCTTGCTACCAATAATTAGGATTATTGCC

TTGCGACAGACCTCCTACTCAGACTGCCTCACATTGAGCTAGTCAGTGAGCGATAAGCTTGACCCGC

TTTCTAGGGTCGCGAGTACGTGAACTAGGGCTCCGGACAGGGCTATATACTCGAGTTTGATCTCGCCC

CGACAACTGCAAACCTCAACTTTTTTAGATAATATGGTTAGCCGAAGTTGCACGAGGTGCCGTCCGCG

GACTGCTCCCCGGGTGTGGCTCCTTCATCTGACAACGTGCAACCCCTATCGCCATCGATTGTTTCTGC

GGACGGTGTTGTCCTCATAGTTTGGGCATGTTTCCCTTGTAGGTGTGAAACCACTTAGCTTCGCGCCGT

AGTCCTAAAGGAAAACCTATGGACTTTGTTTCGGGTAGCACCAGGAATCTGAACCATGTGAATGTGGAC

GTGGCGCGCGTACACCTTAATCTCCGGTTCATGCTAGGGATGTGGCTGCATGCTACGTTGACACACCT

ACACTGCTCGAAGTAAATATACGAAGCGCGCGGCCTGGCCGGAGCCGTTCCGCATCGTCACGTGTTC

GTTTACTGTTAATTGGTGGCACATAAGCAATATCGTAGTCCGTCAAATTCAGCCCTGTTATCCCCGGCGT

TATGTGTCAAATGGCGTAGAACTGGATTGACTGTTTGACGGTACCTGCTGATCGGTACGGTGACCGAGA

ATCTGTCGGGCTATGTCACTAATACTTTCCAAACGCCCCGTATCGATGCTGAACGAATCGATGCACGCT

CCCGTCTTTGAAAACGCATAAACATACAAGTGGACAGATGATGGGTACGGGCCTCTAATACATCCAAC

ACTCTACGCCCTCTTCAAGAGCTAGAAGGGCACCCTGCAGTTGGAAAGGGAATTATTTCGTAAGGCGA

GCCCATACCGTCATTCATGCGGAAGAGTTAACACGATTGGAAGTAGGAATAGTTTCGAACCACGGTTA

CTAATCCTAATAACGGAACGCTGTCTGAAGGATGAGTGTCAGCGAGTGTAACTCGATGAGCTACCCAG

TAGTCGAACTGGGCGAGACAACCCGGCGCTAATGCACTCAATCCCGAGGCCTGACGCGACATATCA

GCTTAGACTAGGGCGGGGGTGTTGACGTTTGGGGTTGAATAAATCTATTGTACTAATCGGCTTCAACGTG

CCCCACGGGTGGCACCTCAGGAGGGGCCCACAGCGAGGAAGTAAACTGTTATTCGTCGGCGATGGT

GGTAGCTAATTATGTTCCTTGCCACTACAATAGTATCTAAGCCGTGTAATGGGAACATCCACACTTTAGT

GAATCGATGCGCGGCTTCAGAATACCGTTTTGGCTACCTGTTACTAAGCCCATCGTGGTTTTCAGATATC

GTGCACGTAGGGTTGCACCGCACGCATGTGGAATTAGTGGCGAAGTACGATTCCACGACCGACGTAC

GATTCAACTATGCGGACGTGACGAGCTTCTTTTATATGCTTCGCCCGCCGGACCGGCCTCGTGATGGG

GTAGCTGCGCATAAGCTTATGACAATTAACGAGTGTGTACTCGTTTTATCATCTCACAGTTAAAGTCGGG

AGAATAGGAGCCGCTACACACAATTTACCGCATCTAGACCTAACTGAGATACTGCCATAGACGACTAC

CCATCCCTCTGGGCCTTAGATAGCCGGATACAGTGACTTTGAAAGGTTTGTGGGGTACAGCTATGACTT

GCTTAGCTGCGTGTGGGGGAAGGAACTTTTGCGTGTTAGTATGTTGACCCGTGTATTACGCATGCGGGT

AGATTATGTAGGTAGAGACATCCAGGTCAAGTTCTCGACCTTCTCGTGGGAGGTGAACCAGTTCACTAT

AGGACCATTCCGTTCGAGCATGGCACTAAGTACGCCCTCCCCATTCTGGTAATCTTCATCCCTATCAGG

GCTTGGAGTGAATGGTGAGGGTTATTCCCCAGGAACAGACTTCCTACTCACAGTCGGTCACATTGGGC

TACTCCTTGGGTCTTCGGCTTGACCCGGTCTGTTGGGCCGCGATTGCGTGAGTTTCGGCCCTGCGCTG

CGCTGTATAGCCGATTCTCATCCGGGCCTCACATCTGGAAACCCCAACCTATTTAGACAGCATCATTGG

CCGAAGTTGCTGGGCATGTCCACCGTGAAGTCCTCCCCGGGCGTCCCTCCTTCAAAAGACGATAAGC

TCCGGCAAGCACCATTGATCAACGCAAGGATCGGTGATGTTAACAAAGATTCGGCACATTACTCTTGTT

GGTGTGGTATCGCTTAACTGCGCGGCGGAGCCTTATGGCAAAACCGTTCGGGAATGATTCCGGTAGCG

CTAAAGGTCCATAGCACGTACATCGCAACCTGGCGTGCGTTCAATTTGACGACCGCTTGGCGCTAAGG

TGCTGGCCACGTGCTAAATTAAAGCGGCTGCACTGCTGTAAGGACGATTACGGAGTGGGCGGCCTGG

GGGGAGCACTACCCCATCGACCTGTACAGGAACACTCTATATTGCTCTCAGACGAACAAATTACTAGA

GTGCCGCTTTCAGCCCCCCTGTCGTCGCCGACGTCTGTAATATGGCGTTGTTGTGATTCGACTCTATTG

AGGCATCAACTGATGCGTAAGGAGATCTGGAATGAATTGGCCTATGTCACTGAAACTGTCCAAACACC

CAATGTCGTTAGTGAAGGTTCTGACGCATACCTCCTTCGTTGAGAACTCACAATTATACAACTGGGGAC

ATAATCCCTACGCCCATCATCTACACGCGTCTCTGTGGCTCCAGTTCATGTATTGGGAGAGTATCCTCC

ACAAGATCTAGTGGTATGGTGGTATAGTAAGCTCGTACTGTGATACACGCGACAGGGGTAGGACCATCA

GTAATAGGGATAGTGCGAAAGCTCACTGACCACTGCCTATAGGGGGTGCTTACTTTTAGAAAAAGTGTC

AGCCAGTATAACCCCACGAGGATTCGAAAAGGTGAACCGAGCCAGACAATCCGGAGGCACGGGGCT

CAAAGCCGCGACACGACGGCTCTCGGCCGGTAACAGTAACCCCGGAGTGAACACCTATGGGGCTGG

ATAAAACTGCCCTGGTGAGCGCCATCAGCAACCCGAATACGTGGCATTTCAGGAGGCGGCCGGAGG

GGGGATGTCTTCTACTATTCGAGGCCGTTCGTTAATACTTGTTGCGTTCCTAGCCGCTATATTTGTCTCTT

TGCCGACTAATGTGAACAACCACACCATAGCGATTTATCGGAGCGCCTCGGAATACGGTATGAGCAGG

CGCCTCGTGAGACCATTGCGAATACCAGGTATCGTGTAAGTAGCGAAGGCCCGTACGCGAGATAAACT

GCTAGGAAACCGCGTCTCTACGACCGGTGCTCGATTTAATTTCGCTGACGTGATGACATTCCAGGCAG

TGCGTCTGCTGCCGGGTCCCTCTCGTGATTGGGTAGTTGGACATGCCCTTGAAAGACATAGCAAGAGC

CTGCCTCTCTATTGATGTCACGGCGAATGTCGGGGAGACAGCAGCGGCTGCAGACATTACATCGGAGT

AACACTAAGGTGGGATAACTCCGTAACTGACTACGCCTTTCTCTAGACCTTACTTGACCAGATACACTG

TCTTTGACACGTTGATGGATTAGAGCAATCACATCCAAGACTGGCTATGCACGAAGCAACTCTTGAGTG

TTAAAATGTTGTCTCCTGTATTCGGGATGCGGGTACTAGATGACTGCAGGGACTCCGACGTTAAGTACA

TTACCCTGTCATAGGCGGCGTTCAGGATCACGTTACCGCCATATGATGCGAGCATGACATCATCTCCGC

TGTGCCCACCCCAGTAGTGATTATTCCTATAACCCTTCTGAGTGTCCGGAGGCGGAAATCCGCCACGA

ATGAGAATGTATTTCCCCGACAATCATAATGGGGCGCTCCTAAGCTTTTCCACTTGGTTGGGCCGGCTA

GGCCTCTCTGCCCGGAGTTTCGGCGCACTGCTGCCGACAGCCGGGCATTGTTTTAGGGGCGTTATTC

GAGGGCACTCGGAGCTAACTTGTCGGGACCAGCCGGGGTAGTCATCGGGCTTATACAGCGAAAAGCC

CAGGACCCGGCTCCACGCTATGGAACGTCTTTAGCTCCGGCAAGCAATTAAGAACAACGCAAGCATC

GCGGATATAAACAGAGAAACGGCCGAATACACCTGTTCGTATCGTATCGGTAAATAGCCTCGCGGAGC

CATGTGCCATACTGGTCTGCGGAGCACTCTGGTTATGCATATGGTCCACAGGACACTCGTCGCTTCCG

GGTATGCGCTCTATGTGACGGTCTTTAGGCGCACTAATGCTCAGCACCATTTAAACCAGACCGACACC

AGATCTGTAAGGTCCGCCACGCAGACGACAGCCCACGGAGATCACCGACCGATCTATCTGATCGGC

GACCATTTGTGTGGTACTGGGGCGGAGAGGTAACTACGGTGCCGCTAACAACCCCTCTGTCGTCGCT

GACGTTTGTAGTCTAGTCTCATTATGATTGTACGCTATTCAGGGATTGACTGATACCGGAAGACATCTCA

GTTGAAGTGGTCTATACGACAGAGACCGTGCACCTACCAAATCTCCTTAGTGTAAGTTCAGACCAATTG

GTAGTTTGTCCAGAACTCAGATTTTAACAGCAGAGGACGCATGCTCTACCTTCATGATCCACTGACGTC

CCTGAGGCTGCAATACATGCAACGAGGCAGTCTCCGCGGTAAGTCCTAGTGCAATGGCGCTTTTTTAC

CCTCGTCCTCGAGAAGAGGGGACGCCAGTGCAGATATCTTTAATGTGGTAATTGGGAGGACTCTTGGC

CCTCCGCCCTTAGGCAGTGCATACTCTTCCATAAACGGGCTGTTAGTTATGGCGTCCGAGGATTCAAAA

AGGTGAGCGAACTCGGCCGATCCGGAGAGACGGGCTTCAAAGCTGCCTGACGACGGTTGCGCGTCC

GTATCAAAATCCTCCTAATAAGCCCCCGTCACTGTTGGTTGAAGAGCCCAGGACGGGTTGGCCAGATG

TGCGATTATATCGCTTAATGGCTCTTGGGCCGCGGTGCGTTACCTTGCAGGAATTGAGGCCGTCCGTTA

ATTTCCCTTGCATACATATTGCGTTTTTTTGTCTTTTTATCCGCTTACTTAGATAAGAGTGACATAGCTTCTT

ACCGGAGCGCCTCCGTACACAGTACGATCGCACGCCCCATGAGATCGATAGGTATACCAGGTGTCCT

GTGAGCAACGAAAGCCTAAACGGGAAATACGCGGCCAAAAGTCGGTGCGAATACGAGTCGTAGCAAT

GTTGGTCTGGCTATGATCTACATATTTCAGGCGGTACGTCTGCTCTGGTCAGCCTCTAATGGCTCGTTAG

ATAGTCTAGCCGCTGGTAATCACTCGATGACCTCGGCTCCCCATTGGTGCTACGGCGATTCTTGGAGA

GCCAGCTGCGATCGCTAATGTGAGGACAGTGTAATATTAGCAAGCGATAAGTCCCCAACTGGTTGTGG

CCTTTTGAAAAGTGAACTTCATAACATATGCTGTCTCACGCACATGGATGGTTTGGACAAATTTGATTCA

AGTCTGATCAACCTTCACACAGATCTAGAATCAAAAGCAGTGATCTCCCGGGTGCGAAATAAAAATACT

AGGTAACTAGAGGGACTGCGACGTTCTAAACGTTGGTCCGTCTGAACCGCCATCCAGGATCACGTCG

CCCCGAAAAAAAGATATCAGGAACTCTCCTCCTCAGCAGTCAGGTCTATGGAAACTACAGGACTAACC

TTCCTGGCAACCGGGGGGTGGGAATCCGTCACATATGAGAAGGTATTTGCTCGATAATCAATACTCCAG

GCATCTAACTTTTCCCACTGCCTTAAGCCGGCTTGCCCTTTCTGCCTGTAGATCCATAGGACTCGTGCC

AACGCGCAGGCATAGTTCGAGGAGAAATATCCGGGGCCAAAGACAACCAGCATCTCGGGTCTTGCCC

AACCCGCCTACATGCTGTTATAGCGAATCAGTGGAAACCCGGTGCCAGGCGATGGAATGTCCTTAACT

CTGGCAGGAAATTAAAGGGAACGTATATACAACGCAAAGAAGCTGGAAAATTGGCGAGAGAATCTTCTT

TCTGTCTATCGAAGAATGGGCATGGGGTGGCAACCGTCATGCTAGCGTGCGGGGTGCACTTGGTAACC

ATTTGGGACACCGGACACTCGCTGTTTTCGAAATTACCCTTTAAGCGCGGGTATTGAACCAGGCTTATG

CCCAGCATCGTTGCAAGCAGACTCAAACTAGATATATTATGCCCGCCATACAGACGAAACTAGTCGGA

GATTATCGAGCATACTATCACGTCGGCGACCACTAGTGAGTTACTAGAGCCGAGGGGCAACGTTGATG

CCCCTAAGAACCTCTGGCTCGACGCAAGCCATAACACCCCTGTCACATCATAATCGTTTGCAATTCAG

GGCTTGATCAACACTGGATTGCCTTTCTCTTAAAGTATTATGCAGGACGGGGTGCGCGTACCATGTAAA

CCTGTTATAACTTACCTGAGACTAGTTGGAAGTGTGGCTAGATCTTAGCTTACGTTTCTAGTCGGTCCAC

GTTTGGTTTTTAAGATCCAATGATCTTCAAAACGCTGCAAGATTCACAACCTGCTTTACTAAGCGCTGGG

TCCTACTGCAGCGGGACTTTTTTTCTAAAGACGTTGAGAGGAGCAGTCGTCAGACCACATAGCTTTCAT

GTCCTGATCGGAAGGATCGTTGGCGCCCGACCCTTAGACTCTGTACTGAGTTCTATAAACGAGCCATT

GCATACGAGATCGGTAGATTGATAAGGGACACAGAATATCCCCGGACGCAATAGACGGACAGCTTGGT

ATCCTAAGCACAGTCGCGCGTCCGAACCTAGCTCTACTTTAGAGGCCCCGGATTCTGGTGCTCGTAGA

CCGCAGAACCGATTGGGGGGATGTACAACAATATTTGTTAGTCACCTTTGGGTCACGATCTCCCACCTT

ACTGGAATTTAGTCCCTGCTATAATTTGCCTTGCATATAAGTTGCGTTACTTCAGCGTCCTAACCGCACC

CTTAGCACGAAGACAGATTTGTTCATTCCCATACTCCGGCGTTGGCAGGGGGTTCGCATGTCCCACGT

GAAACGTTGCTAAACCCTCAGGTTTCTGAGCGACAAAAGCTTTAAACGGGAGTTCGCGCTCATAACTT

GGTCCGAATGCGGGTTCTTGCATCGTTCGACTGAGTTTGTTTCATGTAGAACGGGCGCAAAGTATACTT

AGTTCAATCTTCAATACCTCGTATCATTGTACACCTGCCGGTCACCACCCAACGATGTGGGGACGGCG

TTGCAACTTCGAGGACCTAATCTGACCGACCTAGATTCGGCACTGTGGGCAATATGAGGTATTGGCAG

ACACCCAGTGCCGAACAACACCTGACCTAACGGTAAGAGAGTCTCATAATGCGTCCGGCCGCGTGC

CCAGGGTATATTTGGACAGTATCGAATGGACTGAGATGAACCTTTACACCGATCCGGAAACGGGTGCG

TGGATTAGCCAGGAGCAAACGAAAAATCCTGGGCTACTTGATGTCTTGTGACGTTCTTAGAGATGGAC

GAAATGTTTCACGACCTAGGATAAGGTCGCCCTACAAAATAGATTTGTGCTACTCTCCTCATAAGCAGT

CCGGTGTATCGAAAGAACAAGACTAGCCTTGCTAGCAACCGCGGGCTGGGGGGCTAAGGTATCACTC

AAGAAGCAGGCTCGGTAACATACGGTCTAGCTATCTGACTATCGCCTACGTCATATAGGGACCTATGAT

ATCTGCGTGTCCAACCTTAGAATTCACTTCAGCGCGCAGGTTTGGGTCGAGATAAAATCACCAGTACC

CAAGACCACGGGCGCTCGGCGCCTTGGCTAATCCCGGTACATGTTGTTATAAATAATCAGTAGAAAATC

TGTGTTAGAGGGTCGAGTCACCATATATCAAGAACGATATTAATCGGTGGGAGTATTCAACGTGATGAAG

ACGCTGGGTTTACGTGGGAATGGTGCTTCTGTCCTAACAGGCTAGGGTATAATGCTGAAACCGTCCCC

CAAGCGTTCAGGGTGGGGTTTGCTACGACTTCCGAGTCCAAAGTGTCCGTGTTTTTGATATATACGCTC

AAGGGCGAGAATTGGACCTGGCTTACGTCTTAGTACGTAGCATGGTGACACAAGCACAGTAGATCCTG

CCCGCGTTTCCTATATATTAAGTTAAATCTTATGGAATATAATAACATGTGGATGGCCAGTGGTCGGTTGTT

ACACGCCTACCGCAATGCTGAAAGACCCGGACTAGAGTGGCGAGATCTATGGCGTGTGACCCGTTAT

GCTCCATTTCGGTCAGTGGGTCACAGCTAGTTGTGGATTGGATTGCCATTCTCCGAGTGTTTTAGCGTG

ACAGCCGCAGGGATCCCATAAAATGCAATCGTAGTCCACCTGATCGTACTTAGAAATGAGGGTCCGCT

TTTGCCCACGCACCTGATCGCTCCTCGTTTGCTTTTAAGAACCGGACGAACCACAGAGCATAAGGAGA

ACCTCTAGCTGCTTTACAAAGTACTGGTTCCCTTTCCAGCGGGATGCTTTATCTAAACGCAATGAGAGA

GGTATTCCTCAGGCCACATCGCTTCCTAGTTCCGCTGGGATCCATCGTTGGCGGCCGAAGCCGCCAT

TCCATAGTGAGTTCTTCGTCTGTGTCATTCTGTGCCAGATCGTCTGGCAAATAGCCGATCCAGTTTATCT

CTCGAAACTATAGTCGTACAGATCGAAATCTTAAGTCAAATCACGCGACTAGACTCAGCTCTATTTTAGT

GGTCATGGGTTTTGGTCCCCCCGAGCGGTGCAACCGATTAGGACCATGTAGAACATTAGTTATAAGTCT

TCTTTTAAACACAATCTTCCTGCTCAGTGGTACATGGTTATCGTTATTGCTAGCCAGCCTGATAAGTAACA

CCACCACTGCGACCCTAATGCGCCCTTTCCACGAACACAGGGCTGTCCGATCCTATATTACGACTCC

GGGAAGGGGTTCGCAAGTCGCACCCTAAACGATGTTGAAGGCTCAGGATGTACACGCACTAGTACAA

TACATACGTGTTCCGGCTCTTATCCTGCATCGGAAGCTCAATCATGCATCGCACCAGCGTGTTCGTGTC

ATCTAGGAGGGGCGCGTAGGATAAATAATTCAATTAAGATATCGTTATGCTAGTATACGCCTACCCGTCA

CCGGCCAACAGTGTGCAGATGGCGCCACGAGTTACTGGCCCTGATTTCTCCGCTTCTAATACCGCAC

ACTGGGCAATACGAGCTCAAGCCAGTCTCGCAGTAACGCTCATCAGCTAACGAAAGAGTTAGAGGCT

CGCTAAATCGCACTGTCGGGGTCCCTTGGGTATTTTACACTAGCGTCAGGTAGGCTAGCATGTGTCTTT

CCTTCCAGGGGTATGCGGGTGCGTGGACAAATGAGCAGCATACGTATTTACTCGGCGTGCTTGGTCTC

TCGTATTTCTCCTGGAGATCAAGGAAATGTTTCATGTCCAAGCGAAAAGCCGCTCTACGGAATGGATCT

ACGTTACTGCCTGCATAAGGAGACCGGTGTAGCCAAGGACGAAAGCGACCCTAGGTTCTAACCGTCG

ACTTTGGCGGAAAGGTTTCACTCAGGAAGCAGACACTGATTGACACGGTTTAGCAGAACGTTTGAGGA

CTAGGTCAAATTGAGTGGTTTAATATCGGCATGTCTGGCTTTAAAATTCAGTATAGTGCGCTGATCGGAG

ACGAATTAAAAACACGAGTTCCCAAAACCAGGCGGGCTCGCCACGTCGGCTAATCCTGGTACATTATG

TGAACAATGTTCTGAAGAAAATTTGTGAAAGAAGGACGGGTCATCGCCTACTATTAGCAACAACGGTC

GGCCACACCTTCCATTGTCGTGGCCACGCTCGGATTACACGGCAGAGGTGCTTGTGTTCCGACAGGC

TAGCATATTATCCTAAGGCGTTACCCCAATCGTTTACCGTCGGATTTGCTATAGCCCCTGAACGCTACAT

GTACGAAACCATGTTATGTATGCACTAGGTCAACAATAGGACATAGCCTTGTAGTTAACACGTAGCCCG

GTCGTATAAGTACAGTAGACCCTTCGCCGGCATCCTATTTATTAAGTTATTTCTACAGCAAAACGATCATA

TGCAGATCCGCAGTGGGCGGTAGACACACGTCCACCCGGCTGCTCTGTAACAGGGACTAAAGAGGT

GATGATTATCGTGTGTGCCCCGTTATGGTCGTGTTCGATCAGAGCGCCCTTGCGAGCAGTCGTATGCTT

TCTCGAATTCCGAGCGGTTAAGCGTGACAGTCCCAGCGAACCCACAAAACGTGATCGCAGTCCATGC

GATCATACGCAAGAAGGAAGGTCCCCATACACCGACGCACCAGTTTACACGCCGTATGCATAAACGA

GCTGCACAAACGAGAGTGTTTGAACTGGACCTCTAGTTCCTCTACAAAGAACACCTTGACCTGTTGCG

AAGTTGCCTTGCCTAGATGCAATGTCGGACGTATCACTTTTGCCTCAACGACTGCTGCTTTCGCTGTAA

CCCAAGACAGACAACAGTAACCGCCTTTTGAAGGCAAGTCCTCCGCCTGTGACTAACTGTGCCAAAT

CGTCTTCCAAACCCCTTATCCAATTTAACTCACCAAATTATTGCGATACAGACCCTAATTTCACATCATAT

GACACTAATTGCCTCTGCCAAAATTCTGTCCTCAAGCGTTTTAGTTCGCCCCAGTAATGTTGCCAATAA

GGACCACCAAATCCGCATGTTACAGGACTTCTTATAAATTCTTTTTTCGTGGGGAGCAGCGGATCTTAAT

GGATGGCGCCAGCTGGTATGGAAGCTAATAGCGCCGGTGAGAGGGTAATCAGCCGTCTCCACCAACA

CAACGCTATCGGGTCATATTATAAGATTCCGCAATGGGACTACTTATAGGTTGCCTTAACGATATCCGCA

ACTTGCGATGTGCCTGCTATGCTTAAATACATACCTCGCCCAGTAGCTTTCCAATATGGGAACATCAATT

GTACATCGGGCCGGGATAATCATGTCGTCACGGAACTTACTGTAAGAGTAATAATTCAAAAGAGATGTC

GGTTTGCTAGTTCACGTAAAGGTGCCTCGCGCCACCTCTAAGTAAGTGAGCCGTCGAGACATTATCCC

TGATTTTCTCACTACTATTAGTACTCACGGCGCAATACCACCACAGCCTTGTCTCGCCAGAATGCCGGT

CAGCATATGGAAGAGCTCAAGGCAGGTCAATTCGCACTGTGAGGGTCACATGGGCGTTTGGCACTAC

CGACACGAACCTCAGTTAGCGTACATCCTACCAGAGGTCTGTGGCCCCGTGGTCAAAAGTGCGGGTT

TCGTATTTGCTGCTCGTCTGTACTTTCAGAATCTTGACCTGCACGGCAAAGAGACGCTTTTTATGGAGC

TCGACATGGCAACAACGCGACGGATCTACGTCACAACGAGAATAGTGTAAACGAAGCTGCTGACGGC

GGAAGCGACATAGGGATCTGTGAGTTGTTATTCGCGAAAAACATCCGTCCCCGTGGGGGATAGTCACT

GACGCGGTTTTGTAGAAGCCTAGGGGAACAGGTTAGTTTGACTAGCTTAAGAATGTAAATTCTGGGATTA

TACTGTAGTAATCACTAATTAACGGTGAGGGTTTTAAGACGGATCTTTGCAAATTCAAGCGAGGTGATTT

CAACAAATTTTGCTGATGGTTTAGGCGTACAATCCCCTAAAGTATAATTAAGAAAATAGCATTCCTTGTCG

CCTAGAATTACCTACCGGCGTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAGTCGGCACA

AGTGGATGTGTTGCGATTGCCCGCTAAGATATTCTAAGGCGTAACGCAGATGAATATTCTACAGAGTTG

CCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGGGTCATTGAAGGGTTATACA

CTCGTAGTTAACAACGGGCCCGGCTCTATCAGAACACGAGTGCCTTGAATAACATACTCATCACTAAA

CTTTCTCAACAGTCAATCGAGCAAGTCCATTACCAAGGAGTGCGATGCAGTTTTATTCTCTCGCCAGC

ACTGTAATAGGCACTAAAAGAGTGATGATAATCATGAGTGCTGAGCTAAGACGGCGTCGGTACATAGC

GGTCTTACGGTCAGTCGTAATTCCTCACGAGTCCCGTCCAGTTGAGCGTATCACTCCCAATGTACAAG

CAACCCGAGAAGGCTGTGCTTGGAGTCAATCGGATGTAGGATGGTCTCCAGACACGGGGCCACCAC

TCTTCACGCGTAAAGCAAGAACGTCGAGCAGTCATGAAAGTCTTAGTACCGGACGTGCCGTTTTACTG

CGAATATTACCTGAAGCTGTACCGTTATTGGGGGGCAAAGATGGAGTCCTCCTCTTATCATATTTGTATTG

ACGACAGCCGTGTTCCCGGTTTCCTCAGAGATTTAAGAATAAGGGCTTATTGTAGGCAGAGGGACGCC

CTTTTAGTGGCTGGCGTAAAATATCTTCGGATCCCCTTGTCTAACCAGATTAATCGAATTCTCTCATTTAG

GACCCTAGTAAGTCATCATTGGTGTTTAAATGCCACCCCGAAGAAACCGCCTAAAAATGTCTATGATTG

GTCCACTAAAGTTGATTAAATCAACTCCTAAATCCGCGCGATAGGGCATTAGAGGTTTAATTTTGTATGG

CAAGGTACTCCCGATCTTAATGAATGGCCGGAAGTGGTACGGACGCAATATGCGCGGGTGAGAGGGC

AAATAGGCAGGTTCGCCTACGTTACGCTAGGGGGCGATTCTATAAGAATGCACATTGCATCGATACATA

AGATGTCTCGACCGCATGCGCAACTTGTGAAGTGTCTACTATCCCTAAGCCCATTTCTCGCACAATAAC

CCCTGAATGTGTCCGCATCTGATGTTACCCGGGTTGAGTTAGTGTCGAGCTCGCGGAACTTATTGCATG

AGTAGAGATATGTAAGAGCTGTTAGATAGCTCGCTGAGCTAATAGTTGCCCACAGAACGTCAAAATTAG

AGAACGGTCGTAACATTATCGGTGGTTCTCTAACTACTATCAGTACCCATGACTCGACTCTGCCGCAGC

TACCTATCGCCTGAAAGCCAGTTGGTGTTAAGGAGTGCTCTGTCCAGGACAACACGCGTAGTGAGAGT

TACATGTTCGTTGGGTTCTCCCGACTCGGACCTGAGTCGACCAAGGACCCACTCGAGCTCTGAGCCC

CACTGTCGAGAAGTATGTATCTCGCTCCCGCAGCTTGCCAGCACTTTCAGTATCATGGGGCCCATGGT

TGAATGACTCCTATAACGGACTTCGACATGGCAAAATCCCCCCCTTGCAACTTCTAGAGGAGAAGAGT

ACTGACTTGAGCGCTCCCAGCACAACGGCCAAGGAAGTCTCCAATTTCTTGTTTCCGAATGACACGC

GTCTCCTTGCGGGTAAATCGCCGACCGCAGAACTTAGGAGCCAGGGGGAACAGATAGGTCTAATTAG

GTTAAGGGAGTAAGTCCTCGGATGGTTCAGTTGTAACCATATACTTACGCTGGAACTTCTCCGGCGAAT

TTTTACTGTCACCAACCACGAGATTTGAGGTAAACCAATTGAGCACATAGTCGCGCTATCCGACAATCT

CCAAATTATAACATACCGTTCCATGAAGGCCAGAGTTACTTACCGGCCCTTTCCATGCGCGCGCCATA

CCCCCCCAGTTCCCCGGTTATCTCTCCGAGGAGAGAGTGAGCGATCCTCCGTTAACATATTCTTACGT

ATGACGTAGCTATGTATTTTGCAGAGGTAGCGAACGGGTTTGACACTTCACAGATAGTGGGGATCCGGG

CAAAGGGCGTATAATTGCGGTCCAACATAGGCGTAAACTACGATGGCACCAACTCAGTCGCAGCTCG

TGCGCCGTGAATAACGTACTCATCCCAACTGATTCTCGGCAATCTACGGAGCGACATGATTATCAACA

GCTGTCTAGCAGTTCTAATCTTTTGCCATCGTCGTAAAAGCCTCCAAGAGATTGATCATACCTATCGGC

ACAGAAGTGACACGACGCCGATGGGTAGCGGACTTTTGGTCAACCACAATTCGCTAGGGGACAGGTC

CTGCGGCGTACATCACTTTGTATGTGCAACCAGCCCAAGTGGGGCCAGGCAAGACTCAGCTGGTTCC

TGTGTTAGCTCGAGGCTAGGGATGACAGCTCTTTAAACATAGGCTGGGGGCGTCGAACGGTCGAGAA

GCTCATAGTACCTCGGGTACCAACTTACTCAGGCTATTGCTTGAAGCTGTACTATTTCAGGGGGGGAGC

GCTGATGGTCTCTTCTTCTGATGACTCAACTCGCAAGGGTCGTGAAGTCGGTTCCTTCAATGGTTAAAA

ATCAAAGGCTCACTGTGCAGACTGGAGCGCCCATCTAGCGGCTCGCGTCTCGAATGCTCGGTCCCC

TTTGTCATTCCGGATAAATTCATACCCCTCATTCACTAGCTTGCGAAGTCTACATTGGTATATGAATCCG

ACCTAGAAGAGGGCACTTAAAATTGGGAGTGGTTGATGCTCTATACTCCATTCGGTTTTTTCGTGCATCA

CCGCGAGAGGCTGACAAGGGTTTGACATTGAGTAGCAAGGCACTTCCGGACTCAATGAAGGGCCGG

GAAAGGTACGCGCGTGGTATGGGAGGATCAAGGAGCCAATACAAAGGCTTCATCCTCACTCGCATGG

AGGCAAACGCAGAACAATGGTTACTATTTCGATACGTGAAACATGTCCCACGGTAGCCCAAAGACTTA

AGAGTCTATCACCCCTAGGGCCCTTTCCCGGATATAAACGCCAGGTTGAATCCGCATTTGGAGCTACG

ATGGATGAGTCTGGGTGGAGCGCGCCCCATTTATACCGTGAGTAGGGTCGACCAAGAACCGCAAGAT

GCGTCGGTGTACAAATAATTGTCAACAGACCGTCGTGTTTTGAAAATGGTACCAGCATCTTCGGGCGG

TCTCAATCAAGCATGGATTACGGTGTTTACTCTGTCCTGCGGTTACCCATGGCCTGTAATCCAGCTCGA

GTCAAGCCATTGCCTCTCTGGGACGCCGCATGAACTAATACGTATACTTTGCACGGGTTCACTGCGGT

CCGTTCAGAGTCGACCAAGGACACAATCGAGCTCCCATCTGTATGCTCGACTAACTTGTACCCAACC

CCCGGAGCTTGGCAGCTCCTGGGGTATCATGGAGCCTCTGGTTCATCCCGTGGGATATCAAGCTTCGT

CTTGATAAAGCTCCCCGCTCGGGAGTAGCAGAGAAGACGCCTACTGAATTGTGCGATCCCTGCACCT

CAGCTAAGGTAGCTACCAATATTTAGTTTCTAAGCCTTACGACAGACCTCGCACTTAGATTGCCATGCA

TAGAGCTAACGAGCCAGCGAAAAGCGTGAGGCGCTTTCAAGCATGGCGAGTAAGTGATCCAACGCTT

CGGATACGACTATATACTTAGGTTTGATCTCGCCCCGAGAACTGTAAACCTCAACATTTATAGATTATGA

GGTTAGCCGAAAATGCACGTGGTGGCGCCCGCCGACTGCTCCCAGAGTGTGGCTCTTTGTTCTGTCA

AGGCCCGACCTTCATCGCGGCCGATTCCTTCTGCGGACCATGTCGTCCTGATACTTTGGTCATGTTTC

CGTTGTAGGAGTGAACCCACTTGGCTTTGCGCCATAATTCCAATGAAAAACCTATGCACTTTGTTTAGG

GTACCATCAGGAATCTGAACCCTCAGATAGTGGGGATCCCGGGTATAGACCTTTATCTGCGGTCCAAC

TTAGGCATAAACCTGCATGCTACCTTGTCAGACCCACTCTGCACGAAGTAAATATGGGATGCGTCCGA

CCTGGCTCCTGGCGTTCCACGCCGCCACGTGTTCGTTAACTGTTGATTGGTGGCACATAAGTAATACC

ATGGTCCCTGAAATTCGGCTCAGTTACTTCGAGCGTAATGTCTCAAATGGCGTAGAACGGCAATGACT

GTTTGACACTAGGTGGTGTTCAGTTCGGTAACGGAGAGTCTGTGCGGCATTCTTATTAATACATTTGAAA

CGCGCCCAACTGACGCTAGGCAAGTCAGTGCAGGCTCCCGTGTTAGGATAAGGGTAAACATACAAGT

CGATAGAAGATGGGTAGGGGCCTTCAATTCATCCAGCACTCTACGGTTCCTCCGAGAGCAAGTAGGG

CACCCTGTAGTTCGAAGGGGAACTATTTCGTGGGGCGAGCCCACACCGTCTCTTCTGCGGAAGACTT

AACACGTTAGGGAGGTGGAATAGTTTCGAACGATGGTTATTAATCGTAATAACGGAACGCTGTCTGGAG

GATGAGTCTGACGGTGTGTAACTCGATCAGTCACTCGCTATTCGAACTGCGCGAAAGATCCCAGCGCT

CATGCACTTGATTCCGAGGCCTGTCCCGATATATGAACCCAAACTAGAGCGGGGCTGTTGACGTTTGG

AGTTGAAAAAATCTATTATACCAATCGGCTTCAACGTGCTCCACGGCAGGCGCCTGACGAGGGGCCC

ACACCGAGGAAGTAGACTGTTGCACGTTGGGGATAGCGCTAGCTAACAAAGACGCCTGCTACAACAG

GAGTATCAAACCCGTACAAAGGGAACATCCACACTTTGGTGAATCGAAGCGCGGCATCAGGATTTCC

TTTTGGATACCTGAAACAAAGCCCATCGTGGTCCTTAGACTTGGCACACTTACACCTGCAGCGCGCG

CATGTGGAATTAGAGGCCAAGTTCGATCCCTACACCGACGTACGATGCAACTGTGTGGATGTGACGAG

CTTCATTTATACGCTTCGCGCGCCGGACCGGCCTCCGCAAGGCGCAGCAGTGCACAAGCAAATGAC

AATTAACCACCGTGTATTCGTTATAGCATCAGGCAGTTTAAGTCGGGACAATAGGGGCCGCAATACACA

GTTTACCGCATCTTGACCTAACTGACAAACTGCCATGGACGACTAGCCATGCCATTGGCTCTTAGACA

GCCCGATACAGTGATTATGAAAGGTTTGCGGGGCATGGCTACGACTTGCTCAGCTACGTGCGAGGGC

AGAAACTTTTCCGCATTTGTATGTTCACCTATCTACTACCCATGCCCGGAGATTATGTAGGTTGTGAGAT

GCGGGAGAGGTTCTCGATCTTCCCGTGGGACGTCAACCTTTCCCTTGATAAAGCATTCCGCTCGGGTA

TGGCAGTAAGTACGCCTTCTGAATTGTGCTAACCTTCATCCTTATCAAAGCTTGCTGCCAATGATTAGGA

TTATTGCCTTGCGACAGACTTCCTACTCACACTCGCTCACATTGAGCTACTCGATGGGCCATCAGCTT

GACCCGCTCTGTAGGGTCGCGATTACGTGAGTTAGGGCTCCGGACTGCGCTGTATAGTCGAATCTGAT

CTCGCCCCCACAACTGCAAACCCCAACTTATTTAGATAACATGATTAGCCGAAGTTGCACGGGGTGC

CCACCGTGGACTCCTCCCCGGGTGTCGCTCCTTCATCTGACAATATGCAGCCGCTACCACCATCGAT

TAATACAACGAACGGTGATGTTGTCATAGATTCGGCACATTTCCCTTGTAGGTGTGAAATCACTTAGCTT

CGCGCCGAAGTCTTATGGCAAAACCGATGGACTATGTTTCGGGTAGCACCAGAAGTCTATAGCACGTG

CATCCCAACGTGGCGTGCGTACACCTTAATCACCGCTTCATGCTAAGGTCCTGGCTGCATGCTATGTT

GATACGCCTGCACTGCTCGAAGAAAATATACGAAGCGGGCGGCCTGGCCGGAGCACTACCGCATCG

ACGCGTATTCGAATACTGTTAATTGCTCACACATGAGCAAAATAGTAGACCGTCAATTTCAGCCCTCTTA

TCCTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATTGACTCTATGACGGTATCTGCTGATGGGTAGG

GAGACCCAGAATCTATCGGCCTATGTCACTAAAACTTTCCAAACACCCCATGTCGATACTGAACGAAT

CGACGCACACTCCCTTCCTTGAAAACGCACAATCATACAACTGGGCACATAATGCGTACGCCCATCT

AATACATCCAACTCTCTAGGTCCTGTTCAAGAGCTGGAAGAGCACCCTCCACTTGGTCAAGTGATATC

CTCGTAAGGCAAGCTCGTACCGTCATTCATGCGGAAGGGGTAAGACCATTAGAAGTAGGGATAGTCCC

GAACCTCACTTACCACTCCCAATAAGGGATCCCTGTCTGAAGGATGAGTGTCAGCCAGTGTAACCCG

ATGAGGTACCCAGAAGCCGAACTGGGCCAGACAACCCGGCGCTAACGCACTCAAAGCCGGGACGC

GACGCGACATATCGGCTAAGAGTAGGCCGGGAGTGTAGACCTTTGGGGTTGAATAAATCTGTCGTAGT

AACCGGCTTCAACGACCCGTACAGGTGGCACTTCAGGAGGGGCCCGCAGGGAGGAAGTTTTCTGCT

ATTCGTGGCCGTTCGTGGTAACTAGTTGCGTTCCTAGCCACTACAATTGTTTCTAAGCCGTGTAATGAG

AACAACCACACCATAGCGAATTGATGCGCCGCCTCGGAATACCGTTTTGGCAACCCCTTACTAAGGC

CATCGCGATTTTCAGGTATCGTGCATGTAGGGTTGGACCGCACGCATGTTAAACTGCTGGCGAACCGC

GATTCCACGACCGGTGCACGATTTAATTACGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGC

CGGACCGCCCTCGTGATGGGGTAGCTGGGCATGACCTTGTGACATATAACGAGAGTCTACTTGTTTAA

TCATCTCACGGCGAAAGTCGGGGGGACAGCAGCCGCTGCAGACATTATACCGCAACTACACTAAGCT

GAGATAACTCCGTAGTTGACTACGCATCCCTCTAGGCCTTACTTAACCGGATACAGTGACTTTGACAGG

TTTGTGGGCTACAGCAATCACTTGCATAGCTGCGTATGGAGGAAGCAACTCTTGAGTGTTAATATGTTGA

CCCCTGTATTAGGGATGCGGGTAGTAGATGTGGGCAGAGACACCCAGGTCAAGTACATAACCCTCTC

GTAGGAGGTGTTCCAGATCACCATACCACCATATCATTCGAGCATGACACTATGTACGCTGTCCCCATT

CTGGTAGTCATCATCCCTATCACGGTTTCGAGTGACTGGTGACGGATATCCCCCACGAATGAAAATCTT

ATTCACAGTCGGTCATATTGGGGTGCTCCTTGGCTTTTCCGCTTGGCTCGGTCTGTTAGGCCTCCGTGC

CCCGAGTTTCGGCGCTGTGCTGCCGAGAGTCGGCCATTGTCATTGGGGCCTCACTTGTGGATACCCC

GACCTATTTTGACGGGACCACTCGCGGTAGTCGTTGGGCTTATGCACCGTAAAGTCCTCCGCCGGCC

TCCCCCCTACAAAAGATGATAAGCTCCGGCAAGCAATATTGAACAACGCAAGGATCGGCGATATAAAC

AGAGAAACGGCTGATTACTCTTGTTGGTGTGGTATCGCTAAACTGCGTCGCGGAGCCTTATGGCATAGT

CGTCCGCGGAGCACTCTGGTAACGCTTATGGTCCATAGCACATTCATCGCATCCGGGCATGCGCTCTA

TTTGACGATCCCTTGGCGCAGAGATGCTGGCCACGAGCTAAATTAAAGCGACTGCACTACTGTAAGGT

CCGTCACGCAGACGACGGCCCGGGGAGAGCACTAACCCATCAACCTGTACGGGAACTTTCTATATC

GTTCTCGGACGGAGAGATAACTACAGTGCCGCTTACAGCCCCTCTGTCGTCGCCGACGTCTGTAATAT

AGCCTTGTTGTGATTCCACCCTATTGAGGCATTGACTGATGCGGAAGGAGATCTGGAATGAACTGGTCT

ATGTGACAGAAACTGTGCAAGTACCTAATCTCGTTAGTGTAGGTTCTGACCGATACGTGCTTCGTTGAG

AACTCACAATTTTACAACTGGGGACATAAGCCCTACGCCCATCATCTACTGACGTCCCTGAGGCTGCA

GTTCATGTAATGGGACAGTATCCGCCGCAAGTTCTAGTGCAATGGCGGTATAGTACGCTCGTACTGTAG

TAGAGGCGACACGGGTGGGATCATCACTAATAAGGATACTGGGAAGACTCACAGGCCTCCGCCTATA

GGCGGTGCTTACTCTTACATAAAGCGGCTGTTAGTATTACCCCGCGAGGATTCGAAAAGGTGAACCAA

CCCGGTCGATCCGGAGGGACGGGCCTCAAAGCCGCGTGACGACGGCTGTCGGCCCGTAACAGAAT

CCCCGCAATAAGCTCCCGTGAGCCTCGATTGAACAGCCCTGGTGGGCCCCATCAGTAGCCCGAATAT

GTCGCTTTTCGGGTCCTGGGCCGAGGAGCGATACCTTCCAGTAATCGAGGCCGTTCGTTAATTCTTGT

TGCGTTCCTAGCGCCTATATTTGTCTCTTTGCCGGCTTATGTGGACAAGCATAGCATAGCCATTTATCGG

AGCGCCTCGGTACACGGTATGACCAGACGCCTCGTGAGACCATTACGTATACCAGGTGTCCTGTGAG

CAGCGAAGGCCCATACGCGAGATACACTGCCAGAAATCCGCGTGATTACGAGTCGTGGTAAATTTAAT

CTGGCTGTGGTCTAGACATTCCAGGCGGTGCGTCTGCTGTCGGGTGCCTCTGGTGACTGGCTAGATG

GACTTGCCGCTGGTAAACACACCATGACCCCGCCTCTCCATTGATGCCACGGCGAATGTCGGGGAG

ACAGCAGCGACTGCAGACATCAGATCAGAGTAATACTAACATGCGATAAGTCCCTAACTGACTATGGC

CTTCTGTAGAGTCTACTTCACCAGATATGCTGTCTCTGGCACGTGGATGGTTTAGAGGAATCACATTCA

AGTCTGGTTAACCATGAAACAAGTCTTGAGTGTAAAATTGTCGTCTCCTGTGTACGAGATGGAGGTACT

AGATGACTGCAGGGACTCCGACGTTATGTACGTTGCTCCGTCAAAGGCGCCATTCAGGATCACGTTAC

CGCCAAAAAATGGGAGCAGGAGCTCTTCTCCCCTGCGGTCACGTCTATAGAAATTACACCTTTAACCC

TCCTGAGAACCGGGAGGCGGGAATCCGTCACGTATGAGAAGGTATTTGCCCGACAATCAATACCGGA

CGCTCCTAAGTTTTTCCACTCGCTTGAGCCGGCTAGGCCTCTCTGCCCGAAGTTTCGACGGACTGCT

GCCAACGCCCAGGCATAGTTTTAGGAGGATTATTCGGGGGCACTGGCAACCAACTTCTCGGGTCCTG

CCCGACTGGTCTTCGGGCTAATATAGCGAATTGCCGAGAACCCGGCCCCACGCAATGGAACGTCCTT

AGCTCCGGCAGGCAATTAAGGGGAACGTAAGTATAGCGCAAAAAAACAGAGAAATAGGCGAATGAAT

CTATTCTTACTGTATCGAAGAATGGCCTCGCGGAGGCATGTGTCATGCTAGCGTGCGGGGTACTCTAGT

TATCCATATGGTCCACAGGACACTCGTTGCTTTCGGATTTGCCCTTTATGCGCCGGTTTTCAGCCACGC

TTATGCTCAGCATCGTTATAACCAGACCGATACTAGATCTATAAAGTCCGCCATGCAGACGAGACCAGA

CGGAGATTACCGAGCAATCTATCAGATCGGCGACCATTAGTGAGCTACTGGAGCCGAGGGGTAACTA

CGATGCCGCTAAGAACCTCTCGGTCGTCGCTAGCGATTACACTCCAGTCTCATTATAATCGTTCGCTAT

TCAGGGATTGACCAACACCGGAAAACATTTCACTTGAAGTATTGTATACGACAGAGTCCGTGCACCTA

CCAAACCTGTTTAATCTAAGTTCAGACTAGTTGGAAGTATGTCTAGATCTCAGATTTCGTCACTAGAGGG

CCCACGCTCTATTTTTATGATCCATTGATCTCCCTGACGCTGCAAGATTTGCAACCAGGCAGACTTGGC

GGTAGGTCCTAGTGCAGCGGGGCTTTTTTTCTATAGTCCTTGAGAGGAGGAGACGTCAGTCCAGATATC

TTTGATGTCCTGATTGGAAGGACCGTTGGCCCCCCACCCTTAGGCAGTGTATACTCTTCCATAAACGA

GCTATTAGTTATGAGGTCCGTAGATTGAAAAGGGTGACGGAATTCGGCCGAACGGGAAAGACGGACAT

CTAGGTATCCTGAGCACGGTTGCGCGTCCGTATCAAGCTCCTCTTTATAGGCCCCGGTTACTGTTGGTC

GTAGAGCCCAGAACGGGTTGGGCAGATGTACGACAATATCGCTTAGTCACCCTTGGGCCACGGTCCG

CTACCTTACAGGAATTGAGACCGTCCATTAATTTCCCTTGCATATATATTGCGTTTCTTCGACCTTTTAAC

CGCTCTCTTAGAAGAGAGACAGATAGCTTCTTACCCGTGCCCCACCGTTGGCAGTACGATCGCACGC

CCCACGTGAACGATTGGTAAACCCTGTGGCCTGTGAGCGACAAAAGCTTTAATGGGAAATACGCGCC

CATAACTTGGTGCGAATACGGGTCGTAGCAATGTTCGTCTGAGTATGATCTATATAATACGGGCGGTACG

TCTGCTTTGGTCAGCCTCTAATGGCTCGTATGATAGTGCAGCCGCTGGTGATCACTCAATGATCTCGGC

TCCCCGTTGCAACTACGGGGATTCTTGGAGAGCCAGCTGCGTTCGGTATTGTGAGGACAGTGTAGTAT

TAGCAAACGATAAGTCCCGAACTAGTTGTGACCTAACGAAAAGAGAATTTCATAATACGTGCTGTCCCA

CGCGCATGGTACATTTGGACAATATTGAATGGAGTCTGATCAACCTTCACACCGATCTAGAATCGAATG

CAAAGATCACCCAGGTGCAAATCAAAAATTCTAGGTAACTAGAAGATTTGCGACGTTCTAAGTGTTGGA

CGATATGAATCGCGACCCAGGATGACGTCGCCCTGAAAAAAAGATTTCTGCAACTCTCCTCGTCAGC

AGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAACCGCGGGCTGGGAATCTGAGACATGA

GTCAAGATATTTGCTCGGTAACGTATGCTCTAGGCATCTAACTATTCCCTGTGTCTTATAGGGGCCTGCG

TTATCTGCCTGTCGAACCATAGGATTCGTGTCAGCGCGCAGGCTTGGATCGAGATGAAATCTCCGGGG

CCTAAGACTACGAGCATCTGGCGTCTTGGCTAACCCCCCTACATGTTGTTATAAACAATCAGTGGAAA

CCCAGTGCTAGAGGATGGAATGACCTTAAATCAGGGACGATATTAAACGGAACGTATATTCAACGCAAT

GAAGCCGGAGGATTGGCGTGGGAATCGTGCTTCTGTCTAAGCAAGTAAGGGTATGAGGTCGCAACCG

TCCCCCAAGCGTACAGGGTGCACTTTGTAACGATTTGGGAGTCCAGAGACTCGCTGTTTTCGAAATTT

GCCCTCAAGCGCGAGTATTGAACCAGGCTTACGCCCAAGAACGTAGCAAGCTGACTCAAACAAAATA

CATTTTGCCCGCGTTACATATGAATCAAGTTGGAAGTTATGGAGCATAGTAACATGTGGACGGCCAGTG

GTGGGTTGCTACACCCCTGCGGCAACGTTGAAGCTCCTGGATTACACTGGCTGGATCTAAGCCGTGA

CACCCGTCATACTCCATAACCGTCTGTAACTCACGGCTTGTTCTGGACTGGATTGCCATTCTCTCAGA

GTATTATGCAGGCCGGCGTACGGGTCCCATATAAACCTGTCATAGCTTACCTGACTCTACTTGGAAATG

TGGCTAGGTCTTTGCCCACGCACCTAATCGGTCCTCGTTTGCTTTTTAGGACCCGATGAACTACAGAA

CACTGCAAGAATCTCTACCTGCTTTACAAAGTGCTGGATCCTATTCCAGCGGGATCTTTTATCTAAACA

CGATGAGAGGAGTATTCGTCAGGCCACATAGCTTTCTTGTTCTGATCGGAACGATCGTTGGCGCCCGA

CCCCCCGATTCCATAGTGAGTTCTTCGTCCGAGCCATTGTATGCGAGATCGATAGACTGATAGGGGAT

GCAGTATATCCCTGGATACAATAGACGCACAGGTTGGAATCCTAAGTGAAGTCGCGCGTCCGAACCC

AGCTCTATTTTAGAGGTCATGGGTTCTGGTGCCCGCGAGCCGCGGAACCGATTAGGGGCATGTACAAC

AATATTTATTAGTCATCTTTCAGACACAATCTCCCAGCTCACTGGTATATAGTTCCTGCTATAATTAGCCT

CCCTCATAAGTTGCACTACTTCAGCGTCCCAAATGCACCCTTACCACGAAGACAGGATTGTCCGATCC

CATATTACGACCTTGGCAGGGGGTTCGCAAGTCCCACCCCAAACGATGCTGAAGGCTCAGGTTTCAC

AGGGACAAAAGCTTTAAACGCGAGTTCCCGCTCATAACCTGGACCGAATGCAGAATCATGCATCGTTC

CACTGTGTTCGTGTCATCTAGGACGGGCGCAAAGGATATATAATTCAATTTTGAATACCTTATATTATTGTA

CACCTACCGGTCACCAGCCAACAATGTGCGGATGGCGTTACAACTTTCTGGGCCTAATCTGACCGTT

CTAGATACCGCACTCTGGGCAATACGAGGTAAAGCCAGTCACCCAGTGTCGATCAACACCTAACCTA

ACGGTAAGAGGCTCACATAATGGCACTGTCGGCGTCCCCAGGGTATTTTACGTTAGCATCAGGTGGAC

TAACATGAATCTTTACTCCCAAGCGAAAACGGGTGCGTGGACTAGCGAGGAGCAAACGAAAATTCTTG

GCCTGCTTGGTGTCTCGTATTCCTCTTAGAGATCGACGAAATGTTTCACGACCAAGGGAAAGGTCGCC

CTACAAAATAGATTTGCGTTACTCTCTCCATAAGGAGTCCGGTGTAGCGAAGGATCAAGGCGACCCTA

GGTAGCAACCGCCGGCTTCGGCGGTAAGGTATCACTCAAGAAGCAGACACAGTAAGACACGGTCTA

GCTGACTGTCTATCGGCTAGGTCAAATAGAGAGCTTTGATATCTGCATGTCTAGCTTTAGAATTCAGTTTA

GCGCGCTGATCTGAGTCGAGATAAAATCACCAGTACCCAAGACCAGGGGGGCTCGCCACGTTGGCT

AATCCTGGTACATCTTGTAATCAATATTCAGTAGAAAATTTGTGTTAGAAGGACGAGTCACCATGTACCA

ATAGCGATAACGATCGGTCGGACTATTCATTGTGGTGATGACGCTGGGTTTACGTGGGAAAGGTGCTTG

TGTCCCGACAGGCTAGGATATAATGCTGAGGCCCTTCCCCAAGCGTTCAGCGTGGGATTTGCTACAAC

TTCCGAGTCCTACATGTGCGTGTTCATGTTATGTATGCACAAGGCCGAGAATAGGACGTAGCCTTCGAG

TTAGTACGTAGCGTGGTCGCACAAGCACAGTAGATCCTCCCCGCGCATCCTATTTATTAAGTTAATTCTA

AAGCAATACGATCACATGTGGATGGGCAGTGGCCGGTTGTTACACGCCTACCGCGGTGCTGAATGAC

CGGGACTAAAGAGGCGAAGATTATGGCGTGTGACCCGTTATGCTCGAGTTCGGTCAGTGCGTCATTGC

AAGTAGTCGATTGCTTTCTCAATCTCCGAGCGATTTAGCGTGACAGCCCCAGGGAACCCATAAAATGT

GATCGCAGTCCATCCGATCGTACATAGAAAGGAAGGTCCCCATACGCCCACGCACCTGTTTACTCGT

CGTATGCATAAAAGAGCCGCACGAACCACAGAGCATAAAGAGGACCTCTAGTTCCTTTACAAAGTACA

GGTTCGCTTTTCGGCGAGATGCCTTACCTAGATGCAATGACGGACGTATTCCTCTGGCCACATCGGTT

CCTGCTTTCGCTGGGATCCAAGATTGGCAGCTGAAGCCGCCTTTCCATAGTGAGTCCTTCGTCTGTGA

CTAACTGTGCCAAATCGTCTAGCAAACTGCTGATCCAGTTTAACTCACCAAATTATAGCCGTACAGACC

GAAATCTTAAGTCATATCACGCGACTAGCCTCTGCTTAATTTTTGTGCTCAAGGGTTTTGGTCCGCCCG

AGCGGTGCAGCCGATTAGGACCATGTAATACATTTGTTACAAGACTTCTTTTAAACACTTTCTTCCTGCC

CAGTAGCGGATGATAATCGTTGTTGCCAGCCGGCGTGGAAGGTAACAGCACCGGTGCGAGCCTAATG

TGCCGTCTCCACGAACACAAGGCTGTCCGATCGTATAATAGGATTCCGCAATGGGGTTAGCAAGTGGC

AGCCTAAACGATATCGGGGACTTGCGATGTACATGCTTTGGTACAATACATACGTGATCCAGTTGTTATC

CTGCATCGGAACATCAATTGTGCATCGGACCAGCATATTCATGTCATCTAGGAGGCGCGCGTAGGATA

AATAATTCAATTAAGATGTCGTTTTGCTAGTATACGTCTAGGCGTCACCCGCCATCTGTGTGCAGGTGGG

CCGACGAGACACTGTCCCTGATTTCTCCGCTTCTAATAGCACACACGGGGCAATACCAGCACAAGCC

AGTCTCGCAGCAACGCTCGTCAGCAAACGAAAGAGCTTAAGGCTCGCCAATTCGCACTGTCAGGGT

CGCTTGGGTGTTTTGCACTAGCGTCAGGTACGCTAGTATGCGTTCTTCCTTCCAGGGGTATGTGGCTGC

GTGGTCAAATGTGCGGCATACGTATTTGCTCGACGTGTTTGCTCTCACGAACTTGACCTGGAGATCAA

GGAGATGTTTCTTGTCGAACTGGACAGCGCTTCAACGGAACGGATCTACGTTACAGCCTGCATAATGA

AAACGGAGTTGCCGACGACGAAAGCGACTTTGGGTTCTGTCTGTTGTCATTGGCGGAAAACTTCCGTT

CAGGAGGCGGACACTGATTGACACGGTTTAGCAGAAGGTTTGAGGAATAGGTTAAATTGAGTGGTTTAA

TAACGGTATGTCTGGGATTAAAGTGTAGTATAGTGTGATTATCGGAGACGGTTTTAAGACACGAGTTCCC

AAAATCAAGCGGGGTCATTACAACGGTTATTCCTGGTAGTTTAGGTGTACAATGTCCTGAAGAATATTTA

AGAAAAAAGCACCCCTCATCGCCTAGAATTACCTACTACGGTCGACCATACCTTCGATTATCGCGGCC

ACTCTCGCATTAGTCGGCAGAGGTGGTTGTGTTGCGATAGCCCAGTATAATATTCTAAGGCGTTACCCT

GATGAATATCCAACGGAATTGCTATAGGCCTTGAACGCTACACGGACGATACGAAATTATGTATGGACC

GGGTCATCAAAAGGTTATACCCTTGTAGTTAACATGTAGCCCGGCCCTATTAGTACAGTAGTGCCTTGA

ATGGCATTCTCTTTATTAAGTTTTCTCTACAGCTAAACGATCAAGTGCACTTCCACAGAGCGCGGTGGA

GATTCATTCACTCGGCAGCTCTGTAATAGGGACTAAAAAAGTGATGATAATCATGAGTGCCGCGTTATG

GTGGTGTCGGAACAGAGCGGTCTTACGGCCAGTCGTATGCCTTCTCGAGTTCCGTCCAGTTAAGCGT

GACAGTCCCAGTGTACCCACAAACCGTGATGGCTGTGCTTGGAGTCAATCGCAAGTAGGATGGTCTC

CAGACACCGGGGCACCAGTTTTCACGCCGAAAGCATAAACGACGAGCAGATATGAAAGTGTTAGAAC

TGGACGTGCCGTTTCTCTGCGAAGAACACCTCGAGCTGTAGCGTTGTTGCGCTGCCTAGATGCAGTGT

TGCTCATATCACATTTGCTTCAACGACTGCCGCCTTCGCTGTATCCCTAGACACTCAACAGTAAGCGC

TTTTTGTAGGCAGGGGCACCCCCTATCAGTGACTGCGCCAAAACATCTTCGGATCCCCTTGTCCAATC

AAACTCATCGAATTCTTACATTTAAGACCCTAATATCACATCATTAGTGATTAATTGCCACTGCCAAAATT

CTGTCCAGAAGCGTTTTAGTTCGCTCCACTAAAGTTGTTTAAAACGACTACCAAATCCGCATGTTAGGG

GATTTCTTATTAATTCTTTTATCGTGAGGAACAGCGGATCTTAATGGATGGCCGCAGGTGGTATGGAAGC

TAATAGCGCGGGTGAGAGGGTAATCAGCCGTGTTCACCTACACAACGCTAACGGGCGATTCTATAAGA

TTCCGCATTGCGTCTACTTATAAGATGTCTCAACGGTATCCGCAACTTGTGAAGTGCCTACTATCCTTAA

ACGCATATCTCGCCCAGTAGCTTCCCAATATGTGAGCATCAATTGTTGTCCGGGCCGAGATAGTCATGT

GCTCACGGAACTTACTGTATGAGTAGTGATTTGAAAGAGTTGTCAGTTTGCTGGTTCAGGTAAAGGTTCC

TCACGCTACCTCAAAGTAAGAGAGCGGTCGTGACATTATCCGTGATTTTCTCACTACTATTAGTACTCAC

GACTCGATTCTGCCGCAGCCATGTTTCGCCAGAATGCCAGTCAGCATTAAGGAGAGCTCAGGGCAGG

TCAACTCGCATAGTGAGGGTTACATGTTCGTTGGGCTCTTCCGACACGAACCTCAGTTAGCCTACATC

CTACCAGAGGTCTGTGCCCCGGTGGTGAGAAGTGCGGATTTCGTATTTGCAGCTCGTCAGTACTTTCA

GAATCATGGCCTGCACGGCAAAATGACGCTTATAATGGACTTCGACATGGCAATAACGCCTCGTTTCTA

CGTCAGGAGGAGAATAGTATAAACATAACTGCTGTCGGCAGAAGCGCCAAAGGAGTCTCTGAATTCTT

ATTCCCGAATAACATCCGTCTCCGTGCGGGAAAATCACCGACGGCGTTTTATAGAAGCCTAGGGGAAC

AGATTGGTCTAATTAGCTTAAGAGAGTAAATTCTGGGATCATTCAGTAGTAATCACAAATTTACGGTGGG

GCTTTTTTGGCGGATCTTTACAGATACTAACCAGGTGATTTCAACTAATTTAGTTGACGATTTAGGCGCG

CTATCCCGTAATCTTCAAATTAAAACATAGCGTTCCATGAGGGCTAGAATTACTTACCGGCCTTCACCAT

GCCTGCGTTATTCGCGCCCACTCTCCCATTTATCCGCGCAAGCGGATGCGATGCGATTGCCCGCTAA

GATATTCTTACGTGTAACGTAGCTAAGTATTCTACAGAGCTGGCGTACGCGTTGAACACTTCACAGATG

ATAGGGATTCGGGTAAAGAGCGTGTCATTGGGGGCTTATACAGGCGTAGACTACAATGGGCCCAACTC

AATCACAGCTCGAGCGCCTTGAATAACATACTCATCTCTATACATTCTCGACAATCTATCGAGCGAGTC

GATTATCAACGGGTGTGTTGCAGTTTTAATCTCTTGCCAGCATTGTAATAGCCACCAAGAGATTGATGAT

AGTCATGGGTGCTGAGCTGAGACGGCGTCGATGCATAGCGGACTTTCGGTCAGTCGCAATTCCTCAC

GAGACTGGTCCTGTTGTGCGCATCACTCTCAATGTACAAGCAACCCAAGAAGGCTGAGCCTGGACTC

AACCGGTTGCTGGGTGAACTCCAGACTCGGGGCGACAACTCTTCATACATAGAGCAAGGGCGTCGAA

CGGTCGTGAAAGTCTTAGTACCGCACGTACCAACTTACTGAGGATATTGCCTGAAGCTGTACCGTTTTA

GGGGGGGAAGGTTGAAGATCTCCTCTTCTCATGACTGAACTCGCGAGGGCCGTGTTGCCGGTTCCTT

CAGAGGTTAAAGAACAAAGGCTTACTGTGCGCAGAGGAACGCCCATTTAGCGGCTGGCGTTTTGAATC

CTCGGTCCCCCTTGTCTATCCAGATTAATCCAATTCCCTCATTTAGGACCCTACCAAGTCAACATTGGT

ATATGAATGCGACCTCGAAGAGGCCGCCTAAAAATGACAGTGGTTGGTGCTCTAAACTTCATTTGGTTA

ACTCGTGTATCAGCGCGATAGGCTGTTAGAGGTTTAATATTGTATGGCAAGGTACTTCCGGTCTTAATGA

ATGGCCGGGAAAGGTACGCACGCGGTATGGGGGGGTGAAGGGGCGAATAGACAGGCTCCCCTCTCA

CTCGCTAGGAGGCAATTGTATAAGAATGCATACTGCATCGATACATAAAACGTCTCCATCGCTTGCCCA

AGTTGTGAAGTGTCTATCACCCCTAGGCCCGTTTCCCGCATATTAACGCCTGATTGTATCCGCATTTGAT

GCTACCGTGGTTGAGTCAGCGTCGAGCACGCGGCACTTATTGCATGAGTAGAGTTGACTAAGAGCCG

TTAGATGCCTCGCTGTACTAATAGTTGTCGACAGATCGTCAAGATTAGAAAACGGTAGCAGCATTATCG

GAGGTTCTCTAACTAGTATGGATAGCCGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAAACCA

GTTGGTGTTAAGCGATCCCCTGTCCAGGACGCCACACGTAGTGAAACATACACGTTCGTCGGGTTCA

CCCGGGTCGGATCTGAGTCGACCAAGGACACACTCGAGCTCCGATCCCTACTGTCGAGAAATTTGTA

TCCCGCCCCCGCAGCTTGCCAGCTCTTTGAGTATCATGGAGCCCATGGTTGAATGAGTCCAATAACGA

ACTTCGACATGATAAAGTCCCCCCCTCGCGACTTCCAGAGAAGAAGACTACTGAGTTGAGCGTTCCC

AGCACTTCAGCCAAGGAAGTTACCAATTTTTAGTTTCCGAGTGACACGTCTGACCTTGCGGGTAGATC

GCCGAGCGCAGAACTTACGAGCCAGGGGAAACAGTAAGGCCTATTTAAGTAAAGGGAGTAAGTGATC

GAACGCTTCAGATGTAACCATATACTTAGGCTGGATCTTCTCCCGCGAATTTTAACCCTCACCAACTAC

GAGATATGAGGTAAGCCAAAAAAGCACGTAGTGGCGCTCTCCGACTGTTCCCAAATTGTAACTTATCG

TTCCGTGAAGGCCAGAGTTACTTCCCGGCCCTTTCCATGCGCGCACCATACCCTCCTAGTTCCCCGG

TTATCTTTCCGAAGTGGGAGTGAGCGAACCTCCGTTTACGTCTTGTTACCAATGATGTAGCTATGCACTT

TGTACAGGGTGCCAACGGGTTTCACAATTCACAGATAGTGGGGATCCCGGCAAAGGGCCTATATTTGC

GGTCCAACTTAGGCGTAAACCTCGATGCTACCTACTCAGACCCACCTCGCGCGGGGTAAATAAGGCA

CTCATCCCAGCTGGTTCTTGGCGTTCTACGCAGCGACATGTTTATTAACAGTTGTCTGGCAGCACAAAA

CTTTTACCATGGTCGTAGAAGCCCCCCAGAGTTAGTTCATACCTAATGCCACAAATGTGACAGGACGC

CGATGGGTACCGGACTTTAGGTCGAGCACAGTTCGGTAACGGAGAGACCCTGCGGCGTACTTCATTAT

GTATATGGAACGTGCCCAAGTGACGCCAGGCAAGTCTCAGCTGGTTCCTGTGTTAGCTCGAGGGTAGA

CATACGAGCTGATTGAACATGGGTTGGGGGCCTCGAACCGTCGAGGACCCCATAGTACCTCGGAGAC

CAAGTAGGGCAGCCTATAGTTTGAAGCAGAACTATTTCGGGGGGCGAGCCCTCATCGTCTCTTCTGCG

GATGACTCAACACGCTAGGGACGTGAAGTCGATTCCTTCGATGGTTATAAATCAAAGACTCAGAGTGC

TGTCTGGAGCGTGAATCTAACGGTACGTATCTCGATTGCTCGGTCGCTTTTCGCACTCCGCGAAAGTTC

GTACCGCTCATTCACTAGGTTGCGAAGCCTATGCTGATATATGAATCCAAACTAGAGCAGGGCTCTTAA

GATTCGGAGTTGTAAATACTTAATACTCCAATCGGCTTTTACGTGCACCACCGCGGGCGGCTGACAAG

GGTCTCACATCGAGAAACAAGACAGTTCCGGGCTGGAAGTAGCGCCGGCTAAGGAAGACGCCTGGT

ACGGCAGGACTATGAAACCAGTACAAAGGCAACATCCTCACTTGGGTGAACGGAAACGCAGTATTAT

GGTTACTTTTTGGATACGTGAAACATATCCCATGGTAGTCCTTAGACTTGGGAGTCTATCACCCCTAGGG

CCCATATCTGGAAATAGACGCCAGGTTGAATCCGTATTTGGAGGTACGATGGAACAGTCTGGGTGGGA

CGTGCTTCATTTATACCCTGCGCAGGCTGGACCGAGGACCGCAAGGTGCGGCGGTGCACAAGCAATT

GACAACTAACCACCGTGTATTCATTATGGTACCAGGAACTTTAAGCCGAGTCAATGAAGCTCGCATTAC

AGTGTTTACCGCATCTTGCCGTTACTCACAAACTGTGATCCACCACAAGTCAAGCCATTGCCTCTCTG

ACACGCCGTAAGAATTAATATGTAAACTTTGCGCGGGTTGACTGCGATCCGTTCAGTCTCGTCCGAGG

GCACAATCCTATTCCCATTTGTATGTTCAGCTAACTTCTACCCATCCCCCGAAGTTAAGTAGGTCGTGA

GATGCCATGGAGGCTCTCGTTCATCCCGTGGGACATCAAGCTTCCCCTTGATAAAGCACCCCGCTCG

GGTGTAGCAGAGAAGACGCCTTCTGAATTGTGCAATCCCTCCACCTTATCTAAGCTTGCTACCAATAAT

TAGCATTTTTGCCTTGCGACAGACCTCCTACTTAGATTGCCACACATTGAGCTAGTCAGTGAGCGATAA

GCTTGACGCGCTTTCAAGGGTCGCGAGTACGTGAACTAAGGCTCCGGACAGGACTATATACTTGGGTT

TGATCTCGCCCCGACAACTGCAAACCTCAACTTTTTTAGATTATATGGTTAGCCGAAGTTGCACGAGGT

GGCGTCCGCGGACTGCTCCCCGAGTGTGGCTCTTTCATCTGACAACGTGCAACCCCTATCGCGGCC

GATTGTTTCTGCGGACGATGTTGTCCTCATAGTTTGGGCATGTTTCCCTTGTAGGTGTGAAACCACTTAG

CTTCGCGCCGTAGTCCCAATGAAAAACCTATGGACTTTGTTTTGGGTAGCACCAGGAATCTGAACCGT

GTGAATGTGGACGTCGCGCGCGTAGACCTTTATCTCCGGTTCAAGCTAGGGATGTGGCTGCATGCTAC

GTTGTCACACCTACACTGCTCGAAGTAAATATGCGAAGCGCGCGGCCTGGCCGGAGGCGTTCCGCG

CCGCCACGTGTTCGTTAACTGTTGATTGGTGGCACATAAGCAATATCGTAGTCCGTCAAATTCAGCTCT

GTTATCCCGGGCGTTATGTGTCAAATGGCGTAGAACGGGATTGACTGTTTGACGGTAGCTGCTGATCGG

TACGGTAACGGAGAATCTGTCGGGCTATGTCACTAATACTTTCCAAACGCCCCGTACCGATGCTGAAC

AAGTCGATGCAGGCTCCCGTCTTTGAAAAGGGGTAAACATACAAGTGGATAGATGATGGGTAGGGGCC

TCCAATACATCCAACACTCTACGCCCTCTCCAAGAGCTAGAAGGGCACCCTGCAGTTGGAAAGGGAA

CTATTTCGTAAGGCGAGCCCATACCGTCACTCATGCGGAAGACTTAACACGATAGGAAGCAGGAATAG

TTTCGAACGACGGTTATTAATCCTAATAACGGAACGCTGTCTGAAGGATGAGTGTGAGGGAGTGTAACT

CGATGAGCTACCCGGTAATCGAACTGGGCGAGACATCCCAGCGCTGATGCACTCAATCCCGAGGCC

TGACCCGACATATCAGCTTAGACTAGAGCGGGGCTGTTGACGTTTGGGGTTGAATAAATCTATTGTACC

AATCGGCTTCAACGTGCCCCACGGGTGGCACCTGAGGAGGGGCCCACACCGAGGAAGTAGACTGTT

ATACGTCGGCGATGGTGGTAGCTAACTATGTTGCCTGCCACTACAACAGTATCTAAGCCGTGTAAAGGG

AACATCCACACTTTAGTGAATCGAAGCGCGGCTTCAGAATACCGTTTTGGCTACCTGATACAAAGCCC

ATCGTGGTCCTCAGATATCGTGCACGTAGAGTTGCACCGCACGCATGTGGAATTAGTGGCGAAGTACG

ATTCCAAGACCGACGTACGATACAACTATGCGGATGTGACGAGCTTCTTTTATATGCTTCGCCCGCCGG

ACCGGCCTCGTGATGGCGTAGCTGCGCATAAGCAAATGACAATTAACGAGTGTGTACTCGTTTTATCAT

CTGGCAGTTAAAGTCGGGAGAATAGGAGCCGCAACACACAGTTTACCGCATCTAGACCTAACTGAGAT

ACTGCCATAGACGACTAGCCATCCCTCTGGCTCTTAGATAGCCGGATACAGTGATTTTGAAAGGTTTGT

GGGGTACAGCTATGACTTGCTTAGCTGCGTGTGAGGGAAGGAACTTTTGCGTGTTAGTATGTTGACCCG

TGTACTACGCATGCGGGTAGATTATGTAGGTTGAGAGATGCAGGAGAAGTTCTCGACCTTCCCGTGGG

AGGTGAACCTATTCACTATTGGAGCATTCCGTTCGAGCATGGCAGTAAGTACGCCTTCTCCATTCTGGT

AACCTTCATCCCTATCAGAGCTTGGAGCCAATGATCAGGGTTATTCCCTTGGGACAGACTTCCTACTCA

CAGTCGGTCACATTGGGCTACTCCATGGGTCTTCGGCTTGACCCGGTCTGTTGGGCCGCGATTGCGT

GAGTTTCGGCCCCGCGCTGCGCTGTATAGTCGATTCTCATCCGGCCCTCACATCTGGAAACCCCAAC

TTATTTAGATAACATCATTAGCCGAAGTTGCTGGGCATGTCCACCGTGGAGTCCTCCCCGGGCGTCCC

TCCTTCAAATGACGATAAGCACCGGCAAGCACCATTGATCAACGCAAGGATCGGTGATGTTAACAAAG

ATTCGGCACATTACTCTTGTTGGTGTGGAATCGCTTAACTACGCGGCGAAGCCTTATGGCAAAACCGAT

GGGGAATGATTCGGGTAGCGCTAAAAGTCCATAGCACGTACATCCCAACCTGGCGTGCGTACAGTTTG

ACGACCGCTTCACGCTAAGGTGCTGGCCACGTGCTAAATTAATGCGGCTGCACTGCTCTAAGGACAA

TTACGGAGTGGGCGGCCTGGCGGGAGCACTACCCCATCGACGCGTACTCGAATACTGTATATTGCTCT

CACATGAACAAATTAGTAGAGTGCCGCTTTCAGCCCCCCTGTCGTCGGCGACGTCTGTAAAATGGCGT

TGATGTGGATCGACTCTATAGAGGCATCTACTGATGCGTAGGGAGATCCGGAATGTATTGGCCTATGTC

ACTGAAACTGTCCAAACACCCCATGTCGTTACTGAACGTATCGACGCATACCTCCTTCGTTGAGAACT

CACAATTATACAACTGGGGACATAATCCCTACGCCCATCTTCTACACCCGTCTCTGTGGGTCCAGTTCA

AGTGCTGGGAGAGCATCCTCCACAAGGTCTAGTGGTATGGTGGTATAGTAAGCTCGTACTGTGATACAT

GCGACAGGGGTAAGACCATCAGTAGTAGGGATAGTGCCAAAGCTCACTCACCACTGCCTATAAGGGG

TGCTTACCTCTAGAATAAGTGTCAGCCAGTATAACCCCATGAGGAACCGAAAAGGCGAACCGGGCCA

GACAATCCGGAGGCACCGGGCTCAAAGCCGCGACACGACGGCTCACAGCCGGTAAGAGTAACCCC

GGAGTGAACACCTATGGGGCTGGATAAAACTGCCCTGGTGACCGCCATCAACAACCCGAATACGTGG

CATTTCAGGAGGCGGCCGGAGGGGGGATGTTTTCTACTATTCGAGGCCGTTCGTTATAACTTGTTGCGT

TCCTAGCCGCTATATTTGTCTCTTTGCCGACTAATGAGAACAACCACACCATAGCGATTTGACGCAGCG

CCTCGGAATACCGTATCAGCAGGCGCCTCGTAAGGCCATTGCGAATACCAGGTATCGTGTAAGTAGCG

TAGGCCCGTACGCGAGATAAACTGCTAGGGAACCGCGTCTCTACGACCGGTGCTCGATTTAATTTCGC

CGACGTGATGACATTCCAGGCAGTGCCTCTGCCGCCGGGCCCCTCTCGTGATTGGGTAGTTGGACAT

GCCCTTGAAAGATATAGCAAGAGCCTGCCTGTCTATTGATGTCACGGCGAAAGTCGGGGAGACAGCA

GCGGCTGCAGACATTATACCGGAACAACACTAAGGTGAGATAACTCCGTAACTGACTACGCCTTCCTC

TAGACCTTACTTGACCAGATACAGTGTCTTTGACACGTTTATGGATTACAGCAATCACATCCAAGACTG

GCTATGCACGAAGCAACTCTTGAGTGTTAAAATGTTGACCCCTGTATTTGGGATGCGGGTAGTAGATGA

CTGCAGGGACTCCGACGTCAAGTACATTACCCTCTCATAGGCGGCGTTCTAGATCACGTTACCGCCAT

ATCATCCGAGCATGACATCATCTCCGCTGTGCCCATCCTAGTAGTCATTATTCCTATGACCCTTTTGAGT

GTCCGGTGGCGGATATCCCCCACGAATGAAAATGTTTTTCGCTGACAATCATAATGGGGCGCTCCTAA

GCTTTTCCACTTGGTTGGGCCAGCTAGGCCTCCCTGCCCGGAGTTTCGGCGCAGTGCTGCCGACAG

CCGGGCATTGTCTTTGGGGCGTTATTCGAGGGCACCCGGACCTAACTTGTCGGGACCACCCGGGGTA

GTCATCGGGCTTATACAGCGAAAAGCCCAGCACCCGGCTCCCCGCTATGGAAGGTCATTAGCTCCGG

CAAGCAATTAAGAACAACGCAAGGATCGCGGATATAAACAGAGAAACGGCCGAATACACCTGTTCGT

GTCGTATCGGTAAATAGCCTCGCGGAGCCATGTGCCATACTCGTCTGCGGAGCACTCTGGTAATGCAT

ATGGTCCACAGGACATTCGTCGCTTCCGGGTATGCGCTCTATGTGACGGTCTTTTGGCGCACAAATGC

TCAGCACCATTTAAATTAGACCGACTCCAGATCTGTAAGGTCCGCCACGCAGACGACAGCCCACGGA

GACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGT

GCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGATTGTACGCTATTCAG

GGATTGACTGATACCGGAAGACATCTCAAATGAAGTGGTCTATGCGACAGAGACCGTGCACCTACCAA

ATCTCCTTAGTGTAAGTTCAGACCAATTCGTACTTCGTTCAGAACTCACATTTTAACAACAGAGGACAC

ATGCCCTACCTCCATGATCTACTGACGTCCCTGAGGCTGCAATACATGTAACGAGGCAGTATCCGCGG

TAAGTCCTAGTGCAATGGCGGTTTTTTACCCTCGTCCTGGAGAAGAGGGGACGCCGGTGCAGTCATCA

CTAATGTGGAAATTGGGAGGACTCTTGGCCCTCCGCCTTTAGGCGGTGCTTACTCTTTCATAAAGGGG

CTGTTAGTTATGGCCTGCGAGGATTCAAAAAGGTGAGCGAACTCGGCCGATCCGGAGAGACGGGCTT

CAAAGCTGCCTGACGACGGTTGCGGGTCCGTATCAAAATCCTCCCAATAAGCCCCCGTGACCGTTGG

TTGAACAGCCCAGGACGGGCCGACCAGAAGCCCGATTATATCGCTTAACGGCTCTTGGGCCGGGGT

GCGTTACCTTGCAGGAATCGAGGCCGTCCGTTAATTCCTCTTGCATTCATATCGCGTATTTTTGTCTCTT

TACCCGCTTACTTGGATAAGGATGACATAGCTTCTTACCGGAGCGCCTCCGTACACGGTACGATCGCA

CGCCCCGTGAGATCAATACGTATACCAGGTGTCCTGTGAGCAGCGAAAGCCTAAACGGGAAATACGC

CGCCAAAAGTCGGTGTGAATACGAGTCGTAGCAAATTTGGTCTGGCTATGATCTAGATATTCCAGGCGG

TACGTCTGCTCTGGTCTGCCTCTAGTGGCTCGTTAGATAGTCTAGCCGCTGGTAAACACTCCATGACCT

CGGCTCTCCATTGATGCTACGGCGATTCTTGGAGAGCCAGCAGCGACTGCAAATGTGAGATCAGAGTA

ATATTAGCAAGCGATAAGTCCCTAACTGGTTGTGGCCTTTTGTAGAGTGAACTTCATAACATATGCTGTC

TCAGGCACGTGGATGGTTTGGACAAATCAGATTCAAGTCTGATCAACCTTCATACAGATCTAGAGTCTA

AAGCAGTGATCTCCCGCGTGCGAGATAAAAATACTAGGTAACTAGAGGGACTGCGACGTTCTAAACGT

TGGTCCGTCAGAAGCGCCATCCAGGATCACGTTACCCCGAAAAAAAGATATCAGGAGCTCTCCTCCT

CTGCAGTCAGGTCTATAGAAACTACAGGACTAACCTTCCTGGCAACCGGGAGGTGGGAATCCGTCAC

ATATGAGAAGGTATTTGCCCGATAATCAATACTCCAGGCATCTAACTTTTCCCACTGCCTTAAGCCGGC

TTGCCCTTTCTGCCTGTAGATCCATTGGACTGGTGCCAACGCGCAGGCATAGTTCGAGGAGAATTATC

CGGGGGCAATGACAACCAGCATCTCGGGTCTTGCCCAACCCGTCTACACGCTGTTATAGCGAATCAG

CGGGAACCCGGTGCCACGCGATGGAACGTCCTTAACTCTGGCAGGCAATTAAAGGGAACGTATATATA

ACGCAAAGAAGCTGGAAAATTGGCGAGAGAATCTTCTCTCTGTCTATCGAAGAATGGCCACGCGGTG

GCAACCGTCATGCTAGCGTGCGGGGTACACTTGCTAACCATTTGGGACACGGGACACTCGCTGTTTT

CGAAATTACCCTTTATGCGCGGGTATTGAACCACGCTTATGCCCAGCATCGTTACAAGCAGACTCATAC

TAGATGTATTATGCCCGCCATGCAGACGAAACCAGTCGGAGATTACCGAGCATTCTATCACGTCGGCG

ACCACTAGTGAGCTACTGGAGCCGAGGGGTAACGTTGATGCCCCTAAGAACCTCTCGGTCGACGCAA

GCGATTACACTCCTGTCACATCATAATCGTTTGCTATTCAGGGCTTGACCAACACTGGATTGCTTTTCAC

TTAAAGTATTATGCACGACAGGGTGCGTGTACCATGTAAACCTGTTATAACTTACCTCAGACTAGTTGGA

AGTGTGGCTAGATCTTAGCTTACGTCACTAGAGGGTCCACGTTTAGTTTTTAAGATCCATTGATCTCCTA

AACGCTGCAAGATTCGCAACCTGGTATACTTAGCGCTAGGTCCTAGTGCAGCGGGACTTTTTTTCTAAA

GTCGTTGAGAGGAGGAGTCGTCAGACCAGATAGCTTTGATGTCCTGATCGGAAGGATCGTTGGCCCC

CGACCCTTAGACTCTGTACTCAGTTCTATAAACGAGCCATTGGATACGAGATCCGTAGATTGATAAGGG

ACACGGAATATCCCCGGACGCAATAGACGGACAGCTTGGTATCCTGAGCACAGTCGCGCGTCCGAAT

CTAGCTCTACTTTAGAGGCCCCGGATTCTGATGGTCGTAGACCGCAGAACCGATTGGGGGGATGTACA

ACAATATCTGTTAGTCACCTTTGGGTCACGGTCTGCTACCTTACTGGAATTTAGTCCGTCCTATAATTTC

CCTTGCATATAAGTTGCGTTACTTCGGCCTCCTAACCGCACCCTTAGCACGAAGACAGATTCGTTCTTA

CCCATACTCCACCGTTGGCAGGGGGATCGCATGTCCCACGTGAAACATTGCTAAACCCTCAGGTCTC

TGAGCGACAAAAGCTTTAAAGGGAAATTCGCGCCCATAACTTGGTCCGAATACGGGTTCTTGCATCGT

TCGACTGAGTTTGTTTTATATAAAACGGGCGCAATGTCTGCTTTGATCAACCTCCAATACCTCGTATCAT

TGTGCACCTGCCGGTGACCACTCAACGATGTGGGGACGCCGTTGCAACTTCGAGGACCTAATGTGAC

CGACCTAGATTCGGCATTGTGGGCAGAATGAAGTATTGGCAGACATTGAGTGCCGAACAAGACCTGA

CCTAACGGTAAGAGAGTCTCATAATACGTCCGGCCGCATGCGCAGGGTATATTTGGACAGTATCGAAT

GGACTCTGATGAACCTTTACACCGATCTAGAAACGGGTGCGTGGATTAGCCAGGTGCAAACCAAAAAT

CCTGGGCTACTTGATGTTTTGTGACGTTCTAAGAGTTGGACGAAATGTTTCGCGACCTAGGATGAGGTC

GCCCTAGAAAATAGATTTGTGCTACTCTCCTCATAAGCAGTCCGGTGTATCGAAAGTACAAGACTAGCC

TTGCTAGCAACCGCGGGCTGGGAGCCTAAGGTATCACTCAAGAAACAGGCTCGGTAACATACGCTCT

AGCTATCTGACTATCCCCTACGTCATATAGGGACCTATGTTATCTGCGTGTCCAACCTTAGGATTCACTT

CAGCGCGCAGGCTTGGGTCGAGATAAAATCTCCAGTGCCCAAGACCACGGGCGCTCGGCGCCTTGG

CTAATCCCCGTACATGTTGTTATAAATAATCAGTAGAAAGTCTGTGTTAGAGGGTGGAGTGACCATAAAT

CAAGGACGATATTAATCGGAAGGAGTATTCAACGTGATGAAGTCGCAGGGTTAACGTGGGAATGGTGC

TTCTGTCCTAACAGGTTAGGGTATAATGCTGGAACCGTCCCCCAAGCGTTCAGGGTGGGCTTTGCTAC

GACTTCCGAGTCCAAAGACTCCCTGTTTTCGAAATTTGCGCTCAAGGGCGAGTATTGGACCTGGCTTA

CGCCTTAGTACGTAGCAAGGTGACACAAGCACAGTAGATCCTGCCCGCGTTTCCTATGTATCAAGTTA

GAACTTATGGAATATAATAACATGTGGATGGCCAGTGGTCGGTTGTTACACGCCTGCCGCAACGTTGAA

AGACCCGGATTAGACTGGCAAGATCTATGGCGTGAGACCCGTTATGCTCCATTACGGTCAGTGGGTCA

CAGCTAGTTGTGGATTGGATTGCCATTCTCCGAGTGTATTACCGTGACGGCCGCACGGGTCCCATATAA

TGCAATCGTAGTCTACCTGACTGTACTTAGAAATGTGGCTTCGCCTTTGCCCACGCACCTGATCGCTC

CTCGTTTGCTTTTAAGGACCGGACGAACCACAGAGCATTAGAAGAATCTCTAGCTGCTTTACAAAGTG

CTGGTTCCTTTTCCAGCGGGATGTTTTATCTAAACGCAATGAGAGAGGTATTCCTCAGGCCACATCGCT

TCCTAGTTCCGCTGGGATCCATCGTTGGCGGCCGAAGCCGCCATTCCATAGTGAGTTCTTCGTCTGAG

TCATTCTGTGCCAGATCGACTGACAGATAGCGGATCCAGTTTATCCCTCGAAACTATAGACGTACAGGT

CGAAATCTTAAGTCAAATCGCGCGTCTAGACTCAGCTCTATTTTAGTGGTCATGGGTTCTGGTCCCCCC

GAGCGGCGCAACCGATTAGGACCATGTAGAACATTACTTATAAGTCATCTTTTAAACACAATCTTCCTG

CTCAGTGGTACATGGTTTTCGCTATTGCTAGCCAGCCTCATAAGTAACACCACTACTGCGACCCAAATG

CACCCTTTCCACGAACACAGGGTTGTCCGATCCTATATTACGACTCCGGGAAGGGGTTCGCAAGTCG

CACCCTAAACGATGTTGAAGGCTCAGGATGCACAGGCACAAGTACAATATATACGTGTTCCGGCTCTT

ATCCTGCATCGAAAGCTCAATCATGCATCGTACCAGTGTGTTCGTGTCATCTAGGAGGGGCGCGTAGG

ATAAATAATTCAATTAAGATTACGTTATGCTACTGTACACCTACCCGTCACCGGCCAACAATGTGCGGAT

GGCGCCACGACTTACTGGGCCTGATTTCACCGCTTCTAATACCGCACACTGGGCAATACGAGGTCAA

GCCAGTCACGCAGTAACGTTCATCAGCTAACGTAACAGTTAGAGGCTCGCTAAATCGCACTGTCGGC

GTCCCTTGGGTATTTTACGCTAGCATCAGGTAGGCTAGCATGTATCTTTCCTCCCAGGGGTATGCGGGT

GCGTGGACAAATGAGCAGCAAACGTAAATTCTCGGCGTGCTTGGTGTCTCGTATTTCTCCTGGAGATC

AAGGAAATGTTTCATGACCAAGCGAAAGGCCGCTCTACGGAATGGATTTACGTTACTGCCTGCATAAG

GAGACCGGTGTAGCCAAGGACGAAGGCGACCCTAGGTTCTAACCGTCGACTTCGGCGGTAAGGTAT

CACTCAGGAAGCAGACACTGATAGACACGGTCTAGCAGATCGTTTGACGACTAGGTCAAATTGAGTG

GTTTAATATCGGCATGTCTGGCTTTAGAATTCAGTATAGTGCGCTGATCCGAGTCGAATTAAAAACACCA

GTACCCAAAACCAGGCGGGCTCGCCACGTCGGCTAATCCTGGTACATTTTGTAAACAATGTTCTGAAG

AAAATTTGTGAAAGAAGGACGGGTCATCGCCTACTAATAGCAACAACGATCGGCCGCACCTTCCATTG

TCGTGGCGACGCTCGGATTACACGGCAAAGGTGCTTGTGTTCCGACAGGCTAGCATATAATCCTGAGG

CGTTACCCCAATCGTTCACCGTCGGATTTGCTACAGCCCCTGAACGCTACATGTACGAAACCATGTTA

TGTATGCACTAGGCCAACAATAGGACGTAGCCTTGTAGTTAGTACGTAGCCTGGTCGCATAAGTACAGT

AGATCCTCCCCGCGCATCCTATTTATTAAGTTAATTCTACAGCAAAACGATCATATGCAGATCCGCAGT

GGCCGGTAGACACACGTCCACCCCGCTGCTCTGTGACAGGGACTAAAGAGGCGAAGATTATCGTGT

GTGCCCCGTTATGGTCGAGTTCGGTCAGAGCGTCATTGCGAGTAGTCGTTTGCTTTCTCGAATTCCGA

GCGATTAAGCGTGACAGTCCCAGCGAACCCACAAAACGTGATCGCAGTCCATGCGATCATACGCAA

GAAGGAAGGTCCCCATACACCGACGCACCAGTTTACACGCCGTATGCATAAACGAGCTGCACAAAC

GAGAGTGCTTGAACTGGACCTCTAGTTCCTCTACAAAGAACAGGTTGACCTGTCGCGAAGTTGCCTTG

CCTAGATGCAATGTCGGACGTATTACTTTTGCCTCAACGGCTCCTGCTTTCGCTGAAACCCAAGACAG

GCAACAGTAACCGCCTTTTGAAGGCGAGTCCTTCGTCTGTGACTAACTGTGCCAAATCGTCTTCCAAA

CTCCTAATCCAGTTTAACTCACCAAATTATAGCCATACAGACCCTAATTTCATATCATATCACGCCATTA

GCCTCTGCTAAAATTCTGTGCTCAAGGGTTTTGGTTCGCCCGAGTGATGTTGCCAATTAGGACCATCAA